ID: 1017658104

View in Genome Browser
Species Human (GRCh38)
Location 6:156649136-156649158
Sequence CAGCCTGAGCAGACAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017658101_1017658104 25 Left 1017658101 6:156649088-156649110 CCCAGGATGCAGGGCTGCTACGT No data
Right 1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG No data
1017658102_1017658104 24 Left 1017658102 6:156649089-156649111 CCAGGATGCAGGGCTGCTACGTT No data
Right 1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017658104 Original CRISPR CAGCCTGAGCAGACAGAAGC TGG Intergenic
No off target data available for this crispr