ID: 1017658878

View in Genome Browser
Species Human (GRCh38)
Location 6:156654945-156654967
Sequence TGGGTGTCCTAGTACTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017658878_1017658883 2 Left 1017658878 6:156654945-156654967 CCCTGACAGTACTAGGACACCCA No data
Right 1017658883 6:156654970-156654992 GCAAACCCTGTAAAGACCATGGG No data
1017658878_1017658882 1 Left 1017658878 6:156654945-156654967 CCCTGACAGTACTAGGACACCCA No data
Right 1017658882 6:156654969-156654991 AGCAAACCCTGTAAAGACCATGG No data
1017658878_1017658887 25 Left 1017658878 6:156654945-156654967 CCCTGACAGTACTAGGACACCCA No data
Right 1017658887 6:156654993-156655015 CTCTGCAAACAAAGCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017658878 Original CRISPR TGGGTGTCCTAGTACTGTCA GGG (reversed) Intergenic
No off target data available for this crispr