ID: 1017659895

View in Genome Browser
Species Human (GRCh38)
Location 6:156663670-156663692
Sequence GGGCAGGGTGTTGCCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017659889_1017659895 0 Left 1017659889 6:156663647-156663669 CCCACAGAGGGCAAGCTGAAGCA 0: 37
1: 153
2: 405
3: 629
4: 1043
Right 1017659895 6:156663670-156663692 GGGCAGGGTGTTGCCTCAGCTGG No data
1017659890_1017659895 -1 Left 1017659890 6:156663648-156663670 CCACAGAGGGCAAGCTGAAGCAG 0: 36
1: 152
2: 400
3: 634
4: 1143
Right 1017659895 6:156663670-156663692 GGGCAGGGTGTTGCCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017659895 Original CRISPR GGGCAGGGTGTTGCCTCAGC TGG Intergenic
No off target data available for this crispr