ID: 1017662381

View in Genome Browser
Species Human (GRCh38)
Location 6:156687313-156687335
Sequence CCGCGCGCCCCGCGCCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017662381_1017662392 -5 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662392 6:156687331-156687353 CGCGGGGTCCGGGTCCCGGGCGG No data
1017662381_1017662391 -8 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662391 6:156687328-156687350 GCGCGCGGGGTCCGGGTCCCGGG No data
1017662381_1017662403 21 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662403 6:156687357-156687379 CGGGTGGCGCGGCGGCGCGAGGG No data
1017662381_1017662399 10 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662399 6:156687346-156687368 CCGGGCGGCTCCGGGTGGCGCGG No data
1017662381_1017662402 20 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662402 6:156687356-156687378 CCGGGTGGCGCGGCGGCGCGAGG No data
1017662381_1017662400 13 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662400 6:156687349-156687371 GGCGGCTCCGGGTGGCGCGGCGG No data
1017662381_1017662396 5 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662396 6:156687341-156687363 GGGTCCCGGGCGGCTCCGGGTGG No data
1017662381_1017662390 -9 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662390 6:156687327-156687349 GGCGCGCGGGGTCCGGGTCCCGG No data
1017662381_1017662394 2 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data
1017662381_1017662393 1 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662393 6:156687337-156687359 GTCCGGGTCCCGGGCGGCTCCGG No data
1017662381_1017662404 27 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662404 6:156687363-156687385 GCGCGGCGGCGCGAGGGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017662381 Original CRISPR CCGCGCGCCCCGCGCCGGGC GGG (reversed) Intergenic