ID: 1017662386

View in Genome Browser
Species Human (GRCh38)
Location 6:156687317-156687339
Sequence GACCCCGCGCGCCCCGCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017662386_1017662396 1 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662396 6:156687341-156687363 GGGTCCCGGGCGGCTCCGGGTGG No data
1017662386_1017662403 17 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662403 6:156687357-156687379 CGGGTGGCGCGGCGGCGCGAGGG No data
1017662386_1017662404 23 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662404 6:156687363-156687385 GCGCGGCGGCGCGAGGGTTCCGG No data
1017662386_1017662392 -9 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662392 6:156687331-156687353 CGCGGGGTCCGGGTCCCGGGCGG No data
1017662386_1017662400 9 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662400 6:156687349-156687371 GGCGGCTCCGGGTGGCGCGGCGG No data
1017662386_1017662402 16 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662402 6:156687356-156687378 CCGGGTGGCGCGGCGGCGCGAGG No data
1017662386_1017662394 -2 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data
1017662386_1017662399 6 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662399 6:156687346-156687368 CCGGGCGGCTCCGGGTGGCGCGG No data
1017662386_1017662393 -3 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662393 6:156687337-156687359 GTCCGGGTCCCGGGCGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017662386 Original CRISPR GACCCCGCGCGCCCCGCGCC GGG (reversed) Intergenic