ID: 1017662387

View in Genome Browser
Species Human (GRCh38)
Location 6:156687318-156687340
Sequence GGACCCCGCGCGCCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017662387_1017662405 30 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662405 6:156687371-156687393 GCGCGAGGGTTCCGGCCGCGCGG No data
1017662387_1017662402 15 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662402 6:156687356-156687378 CCGGGTGGCGCGGCGGCGCGAGG No data
1017662387_1017662396 0 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662396 6:156687341-156687363 GGGTCCCGGGCGGCTCCGGGTGG No data
1017662387_1017662393 -4 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662393 6:156687337-156687359 GTCCGGGTCCCGGGCGGCTCCGG No data
1017662387_1017662403 16 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662403 6:156687357-156687379 CGGGTGGCGCGGCGGCGCGAGGG No data
1017662387_1017662394 -3 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data
1017662387_1017662399 5 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662399 6:156687346-156687368 CCGGGCGGCTCCGGGTGGCGCGG No data
1017662387_1017662392 -10 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662392 6:156687331-156687353 CGCGGGGTCCGGGTCCCGGGCGG No data
1017662387_1017662404 22 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662404 6:156687363-156687385 GCGCGGCGGCGCGAGGGTTCCGG No data
1017662387_1017662400 8 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662400 6:156687349-156687371 GGCGGCTCCGGGTGGCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017662387 Original CRISPR GGACCCCGCGCGCCCCGCGC CGG (reversed) Intergenic