ID: 1017662394

View in Genome Browser
Species Human (GRCh38)
Location 6:156687338-156687360
Sequence TCCGGGTCCCGGGCGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017662383_1017662394 1 Left 1017662383 6:156687314-156687336 CCGCCCGGCGCGGGGCGCGCGGG No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data
1017662386_1017662394 -2 Left 1017662386 6:156687317-156687339 CCCGGCGCGGGGCGCGCGGGGTC No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data
1017662387_1017662394 -3 Left 1017662387 6:156687318-156687340 CCGGCGCGGGGCGCGCGGGGTCC No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data
1017662380_1017662394 3 Left 1017662380 6:156687312-156687334 CCCCGCCCGGCGCGGGGCGCGCG No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data
1017662381_1017662394 2 Left 1017662381 6:156687313-156687335 CCCGCCCGGCGCGGGGCGCGCGG No data
Right 1017662394 6:156687338-156687360 TCCGGGTCCCGGGCGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017662394 Original CRISPR TCCGGGTCCCGGGCGGCTCC GGG Intergenic
No off target data available for this crispr