ID: 1017663277

View in Genome Browser
Species Human (GRCh38)
Location 6:156694626-156694648
Sequence ATGAATAAACAGATAAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017663270_1017663277 12 Left 1017663270 6:156694591-156694613 CCAAAAGGGGGAAACAACCCATA No data
Right 1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG No data
1017663273_1017663277 -6 Left 1017663273 6:156694609-156694631 CCATATGCCCATGGCAGATGAAT No data
Right 1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG No data
1017663272_1017663277 -5 Left 1017663272 6:156694608-156694630 CCCATATGCCCATGGCAGATGAA No data
Right 1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017663277 Original CRISPR ATGAATAAACAGATAAATGG TGG Intergenic
No off target data available for this crispr