ID: 1017664223

View in Genome Browser
Species Human (GRCh38)
Location 6:156703700-156703722
Sequence CAGTGTCTGCCCAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017664223_1017664229 1 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664229 6:156703724-156703746 CTGAAAAAAAATGGGACTCAAGG No data
1017664223_1017664227 -8 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664227 6:156703715-156703737 AGACACTGGCTGAAAAAAAATGG No data
1017664223_1017664235 18 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664235 6:156703741-156703763 TCAAGGAGGGAGAAGGAGGGAGG No data
1017664223_1017664232 11 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664232 6:156703734-156703756 ATGGGACTCAAGGAGGGAGAAGG No data
1017664223_1017664234 15 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664234 6:156703738-156703760 GACTCAAGGAGGGAGAAGGAGGG No data
1017664223_1017664233 14 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664233 6:156703737-156703759 GGACTCAAGGAGGGAGAAGGAGG No data
1017664223_1017664231 5 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664231 6:156703728-156703750 AAAAAAATGGGACTCAAGGAGGG No data
1017664223_1017664230 4 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664230 6:156703727-156703749 AAAAAAAATGGGACTCAAGGAGG No data
1017664223_1017664228 -7 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664228 6:156703716-156703738 GACACTGGCTGAAAAAAAATGGG No data
1017664223_1017664236 19 Left 1017664223 6:156703700-156703722 CCTGTGTCCCTGGGCAGACACTG No data
Right 1017664236 6:156703742-156703764 CAAGGAGGGAGAAGGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017664223 Original CRISPR CAGTGTCTGCCCAGGGACAC AGG (reversed) Intergenic
No off target data available for this crispr