ID: 1017666102

View in Genome Browser
Species Human (GRCh38)
Location 6:156721435-156721457
Sequence ACCTGGGTGGAGAGATCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017666097_1017666102 -9 Left 1017666097 6:156721421-156721443 CCAGGTGTAGAGAGACCTGGGTG No data
Right 1017666102 6:156721435-156721457 ACCTGGGTGGAGAGATCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017666102 Original CRISPR ACCTGGGTGGAGAGATCCGG GGG Intergenic