ID: 1017672068

View in Genome Browser
Species Human (GRCh38)
Location 6:156778042-156778064
Sequence CGCTGCCGCCGCGGAGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 2, 1: 1, 2: 10, 3: 33, 4: 375}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017672068_1017672075 3 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672075 6:156778068-156778090 GCATCCTCTTCCTCCTCGTCGGG 0: 1
1: 0
2: 3
3: 56
4: 398
1017672068_1017672086 27 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672086 6:156778092-156778114 CCGGGCTCGGCCATGGAGACGGG 0: 1
1: 0
2: 0
3: 10
4: 143
1017672068_1017672082 20 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672082 6:156778085-156778107 GTCGGGCCCGGGCTCGGCCATGG 0: 1
1: 0
2: 1
3: 11
4: 191
1017672068_1017672074 2 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672074 6:156778067-156778089 GGCATCCTCTTCCTCCTCGTCGG 0: 1
1: 0
2: 1
3: 21
4: 248
1017672068_1017672087 28 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672087 6:156778093-156778115 CGGGCTCGGCCATGGAGACGGGG 0: 1
1: 0
2: 0
3: 7
4: 96
1017672068_1017672084 26 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672084 6:156778091-156778113 CCCGGGCTCGGCCATGGAGACGG 0: 1
1: 0
2: 1
3: 13
4: 144
1017672068_1017672077 8 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672077 6:156778073-156778095 CTCTTCCTCCTCGTCGGGCCCGG 0: 1
1: 0
2: 1
3: 29
4: 196
1017672068_1017672078 9 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672078 6:156778074-156778096 TCTTCCTCCTCGTCGGGCCCGGG 0: 1
1: 0
2: 1
3: 29
4: 225
1017672068_1017672080 14 Left 1017672068 6:156778042-156778064 CCTCCTCCTCCGCGGCGGCAGCG 0: 2
1: 1
2: 10
3: 33
4: 375
Right 1017672080 6:156778079-156778101 CTCCTCGTCGGGCCCGGGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017672068 Original CRISPR CGCTGCCGCCGCGGAGGAGG AGG (reversed) Exonic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900247236 1:1642415-1642437 CGCTCCCGCGGCGGCCGAGGCGG + Exonic
900258460 1:1709547-1709569 CGCTCCCGCGGCGGCCGAGGCGG + Exonic
900561685 1:3310206-3310228 AGCTGCAGCCGCTGTGGAGGTGG - Intronic
900947087 1:5837143-5837165 CGCTGCCGGTGGGCAGGAGGAGG - Intergenic
903247327 1:22025615-22025637 AGCTGCCACCTCGGAGGACGGGG - Intergenic
904005440 1:27360944-27360966 CACGGCGCCCGCGGAGGAGGCGG - Exonic
905617955 1:39414026-39414048 CACTGCAGCTGCTGAGGAGGTGG - Exonic
906641576 1:47444064-47444086 CGCTGCGGCGGCGCTGGAGGAGG - Intergenic
908131839 1:61082370-61082392 CGCCGCCGCCGCGGGGGGGAGGG - Intronic
911116022 1:94247520-94247542 CGCTTCGGCCGCGGCGGTGGTGG - Intronic
912993450 1:114510974-114510996 CGGGCCCGCCGCGCAGGAGGCGG - Exonic
913565557 1:120069418-120069440 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
913632574 1:120724138-120724160 GGCGGCGGCGGCGGAGGAGGAGG + Intergenic
914286154 1:146228793-146228815 CGCGGCGGCGGCGGCGGAGGAGG - Exonic
914619324 1:149390818-149390840 GGCGGCGGCGGCGGAGGAGGCGG + Intergenic
915018718 1:152760357-152760379 AGCTGCAGCCGCCGAGGAGGAGG - Exonic
915246398 1:154558766-154558788 CGGGGCCGCCTAGGAGGAGGAGG - Intronic
915724517 1:158008134-158008156 CGCTGCCGGCTAGGAGCAGGAGG - Intronic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
917345138 1:174021969-174021991 CGCTGCCGCGGAGGAGCAGAGGG + Intronic
917433951 1:175000132-175000154 AGCTGCAGCCGCGCAGAAGGAGG - Exonic
919916965 1:202144761-202144783 GGCGGCGGCGGCGGAGGAGGAGG - Intergenic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
921023764 1:211259432-211259454 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
922314894 1:224434193-224434215 CACTACCACCACGGAGGAGGAGG + Exonic
922498964 1:226083198-226083220 TGCTGCCCCCGAGGAGGAGTTGG - Intergenic
922668674 1:227493028-227493050 CGCCACAGCCGAGGAGGAGGAGG - Intergenic
922670922 1:227508271-227508293 CGCCACAGCCGAGGAGGAGGAGG + Intergenic
923318516 1:232805536-232805558 CGCTGCCGCAGTGGAGCAGGAGG + Exonic
923650296 1:235867052-235867074 CGCTGCCCTCCCAGAGGAGGCGG - Intronic
1064052359 10:12069297-12069319 CGCGGCCGGTGGGGAGGAGGGGG + Intronic
1064230923 10:13528887-13528909 CGCGGCGGCGGCGGCGGAGGCGG + Intronic
1065043144 10:21717757-21717779 AGCAGCAGCAGCGGAGGAGGAGG - Intronic
1065099760 10:22321381-22321403 GGCGGCGGCCGAGGAGGAGGAGG + Exonic
1066464871 10:35642235-35642257 TGCTCCCGCCGAGGAGGAGGCGG - Exonic
1066464872 10:35642238-35642260 CGCTGCTCCCGCCGAGGAGGAGG - Exonic
1067484540 10:46635495-46635517 CGCCGCCGCCGCGGTTGATGTGG - Intergenic
1067610219 10:47706152-47706174 CGCCGCCGCCGCGGTTGATGTGG + Intergenic
1070079143 10:73168296-73168318 CCCGGCCGCGGCTGAGGAGGAGG + Exonic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1071784091 10:88880165-88880187 CGCCGCCGCCACAGAGGAGGGGG + Exonic
1072562228 10:96586887-96586909 GGCGGCGGCGGCGGAGGAGGCGG - Exonic
1072679707 10:97498357-97498379 CGCTGCCGCGGCTGTGGAGGCGG - Exonic
1072915524 10:99535456-99535478 CGCTGCTGCGGCGGCGGCGGCGG - Exonic
1073099600 10:100999784-100999806 CGGGGGCGCCGCGGAGGCGGAGG + Exonic
1073196266 10:101694613-101694635 GGCGGCGGCCGGGGAGGAGGAGG - Exonic
1073325572 10:102642670-102642692 CGCCGCCGCCGCGAGGAAGGCGG - Intergenic
1075519707 10:123136254-123136276 CGCTGCCGCGGCGGCCAAGGGGG + Exonic
1075629320 10:123991693-123991715 GGCGGCGGCGGCGGAGGAGGCGG + Intergenic
1075645443 10:124093264-124093286 CGCTCCCGGCGCGGTGGTGGCGG - Intronic
1077886277 11:6390364-6390386 CGCTGCGGAGGCGGAGGGGGCGG - Intergenic
1080540099 11:33257313-33257335 CGGTGGCGCTGCGGAGGCGGTGG + Intronic
1081705665 11:45180871-45180893 CCCTGCTGGCTCGGAGGAGGGGG + Intronic
1082076594 11:47980402-47980424 CGCGGCCGGCTCGGAGGGGGCGG + Intergenic
1083900495 11:65641065-65641087 CGCTGCCGCTGCGCAGGAGTGGG - Exonic
1084010334 11:66344885-66344907 TGCTTCGGCCTCGGAGGAGGAGG + Intronic
1084546229 11:69816452-69816474 CGCCGCCCCCACGGAGGGGGCGG + Intronic
1084566231 11:69930613-69930635 AGCTGCCACCGTGGAGGCGGTGG - Intergenic
1086424761 11:86672353-86672375 CGGTCCCGCTGCGGAGCAGGCGG + Exonic
1087188814 11:95231171-95231193 CGCTGCGGCGGCGGTGGTGGCGG - Exonic
1089100635 11:115959368-115959390 AGCTGCAGGCGCGGAGCAGGGGG - Intergenic
1089563220 11:119356415-119356437 CGCCCGCGCCGCGGAGGAGCCGG - Exonic
1090002742 11:122976881-122976903 CGCTGGCGCCGCGCAGTACGCGG + Intergenic
1090664397 11:128905288-128905310 CTCTGCGGCTGCGGAGGAGGCGG - Intronic
1091281520 11:134384279-134384301 CCCTGCAGCGGGGGAGGAGGAGG - Intronic
1091823169 12:3491301-3491323 CGCCGCCGCCGCGGAGGCTTCGG + Exonic
1092243813 12:6851930-6851952 CGCTCCCGCCCTGGAGGAGTGGG + Exonic
1093547931 12:20369566-20369588 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1096700612 12:53380466-53380488 CGGGGCCTCCGAGGAGGAGGGGG + Intronic
1096771556 12:53938991-53939013 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1101253832 12:102958363-102958385 CGCTGCCGCTGCGGCGGCTGCGG - Exonic
1103901762 12:124307107-124307129 CGATGCCCCCGCGGATGGGGAGG - Intronic
1103903682 12:124316430-124316452 GGCTGCCACTGCGGAGCAGGCGG + Intergenic
1103933198 12:124461243-124461265 GGCTGACGCCGCAGGGGAGGTGG + Intronic
1104810990 12:131620349-131620371 CTCTGCCGCCGCACAGGAGGGGG - Intergenic
1104841453 12:131828032-131828054 CGCCGCCGCAGCGCAGCAGGTGG - Intergenic
1104957745 12:132474670-132474692 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957755 12:132474693-132474715 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957843 12:132474902-132474924 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104957892 12:132475015-132475037 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1104958066 12:132475410-132475432 CGGGGTCACCGCGGAGGAGGGGG - Intergenic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1105745725 13:23375525-23375547 CGCGGCGGCCGAGGAGCAGGCGG + Intronic
1106269360 13:28138707-28138729 CGCCGCCGCCAGCGAGGAGGAGG - Exonic
1111951457 13:94712174-94712196 CGCTCCCGCCCCGGAGGAGGGGG + Exonic
1113806024 13:113110357-113110379 CGATGCCGGCGAGGAGAAGGCGG - Intronic
1114259284 14:21025548-21025570 CGGGACCGCCGCTGAGGAGGCGG + Intronic
1114557643 14:23571122-23571144 CGCTGCAGCCTCCGAGGAGTGGG + Exonic
1115320828 14:32077394-32077416 CGCTGCCGTTGAGGAGGAGACGG + Exonic
1115399156 14:32938859-32938881 GGCGGCGGCGGCGGAGGAGGAGG - Intronic
1116657949 14:47674897-47674919 CGCAGACGCCGGGGAGGAGCAGG + Exonic
1117478363 14:56118947-56118969 CGCTGTCCGCGCGGAGGACGCGG + Intronic
1118169043 14:63367318-63367340 AGCTGCTGCCCCAGAGGAGGTGG + Intergenic
1118992457 14:70809105-70809127 CGCTGCCGCCCCGCCGGGGGAGG - Exonic
1122150222 14:99721648-99721670 TGCTGCCGCCGCACAGCAGGAGG + Intronic
1122264152 14:100538934-100538956 CGCGGCCGAGGAGGAGGAGGAGG - Exonic
1122658472 14:103278998-103279020 CGGAGCCGGGGCGGAGGAGGCGG - Intergenic
1123047666 14:105526690-105526712 GGCTGCGTCCGCGGAGGGGGCGG + Intronic
1124453875 15:29822557-29822579 CGGGGCCGCGGCGGGGGAGGGGG + Intronic
1124922288 15:34038838-34038860 CGCGGAGGCCGAGGAGGAGGAGG - Exonic
1124957224 15:34367313-34367335 CGCGGCGGGCGCGGAGGAGCAGG - Intergenic
1126502918 15:49366758-49366780 CGCTGCCTCCGTGGCGGGGGCGG + Intronic
1126736660 15:51737674-51737696 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
1126849867 15:52790364-52790386 CGCTGCGGCGGCGGCGGCGGCGG - Intronic
1127144107 15:56007279-56007301 TGCTGCGGCGGCGGGGGAGGCGG + Intergenic
1128142338 15:65310938-65310960 CGCTGGAGCCCCGGAGGTGGAGG + Intergenic
1128565837 15:68699989-68700011 CGCTGCAGCCTGGGAGGGGGTGG + Intronic
1129051313 15:72783891-72783913 TGTTGCCGCCCCGGAGGAGGTGG + Intronic
1129188530 15:73924747-73924769 AGCTGCTGCAGCAGAGGAGGGGG - Intergenic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1132547513 16:540200-540222 CTCTGCGGCCAGGGAGGAGGCGG - Intronic
1132585789 16:705344-705366 CCCAGCGGCCGCGGGGGAGGTGG + Intronic
1132618986 16:855529-855551 CTCGGCTGCCCCGGAGGAGGAGG + Intronic
1132741069 16:1413801-1413823 CGCTGCCTGGGCGGAGGTGGGGG - Intronic
1132889425 16:2196594-2196616 GGCTCCCGGCGCGGAGGGGGCGG + Intergenic
1135437208 16:22437102-22437124 CGCCGGGGCCGCGGAGGACGAGG - Intronic
1136112427 16:28072868-28072890 CGCTGGAGCCCTGGAGGAGGAGG + Intergenic
1136447918 16:30335301-30335323 CGCTGGGGCCCCGGAGGACGAGG + Intergenic
1136588488 16:31202727-31202749 CGCTGCAGCCGCCGACCAGGAGG + Exonic
1137412927 16:48244630-48244652 GGCTGCCCCCGCGGCGGCGGCGG + Intronic
1138328075 16:56191774-56191796 GGCGGCGGCGGCGGAGGAGGAGG - Intronic
1138513992 16:57525968-57525990 CACAGCTGCCACGGAGGAGGAGG - Exonic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1140354881 16:74297057-74297079 CGCGGCGGCCGCGGACGAGCTGG + Intronic
1141141182 16:81497801-81497823 GGCTGCAGCAGCAGAGGAGGCGG - Intronic
1141503996 16:84462817-84462839 CCCTGCCGGCGGGGAGGCGGTGG - Intronic
1141516319 16:84547690-84547712 CGCTGCTGCTGCAGAGGAGTTGG - Intronic
1141538556 16:84700264-84700286 CGCGGCGGGCGCGGAGGCGGCGG - Intronic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141840130 16:86568577-86568599 CGGGGCCGCCGCGGCGCAGGCGG + Exonic
1141988274 16:87594071-87594093 CGCTGGCACAGGGGAGGAGGAGG + Intergenic
1142757642 17:2025242-2025264 TGCTGCAGCCGCGGCGGCGGTGG - Exonic
1142863405 17:2776812-2776834 CCCCGCCGCCCCGGAGGAGGAGG + Intergenic
1142863408 17:2776815-2776837 CGCCGCCCCGGAGGAGGAGGAGG + Intergenic
1143063292 17:4221971-4221993 CGATGCCGCCAAGGAGGTGGCGG + Intronic
1143099870 17:4499077-4499099 GGCGGGCGGCGCGGAGGAGGAGG + Exonic
1143223761 17:5282696-5282718 GGCTGCCGTCGCTGGGGAGGGGG + Intronic
1143590665 17:7884683-7884705 GGACGCCGCCGCCGAGGAGGAGG + Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1143590668 17:7884689-7884711 CGCCGCCGAGGAGGAGGAGGAGG + Intronic
1143783249 17:9240282-9240304 CGCGGCCGCCGTGGAGGGGCTGG + Exonic
1144682599 17:17205623-17205645 CGGTGCCTCCGCGGTGGGGGCGG - Intronic
1145066016 17:19761953-19761975 CACTGAGGCCGAGGAGGAGGAGG - Intergenic
1145826204 17:27878936-27878958 CGCTGCAGGAGCAGAGGAGGGGG + Exonic
1146187283 17:30732037-30732059 CGGTAACGCCGCGGAGGAGGAGG - Intergenic
1146332332 17:31937410-31937432 TGCCGCCGCGGAGGAGGAGGAGG - Exonic
1146332333 17:31937413-31937435 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1146332335 17:31937416-31937438 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1147971294 17:44220067-44220089 TGCTGCCGCCGCCGGGGAAGGGG + Intronic
1148060083 17:44830171-44830193 GGCGGCAGCGGCGGAGGAGGTGG - Intronic
1148437165 17:47693964-47693986 CGGAGCAGCCGGGGAGGAGGAGG + Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150258997 17:63773484-63773506 CGCTGCGATCGCGGAGGCGGCGG - Exonic
1152455835 17:80415574-80415596 CGCTGCAGCCGCGCGGGTGGAGG + Intronic
1152565118 17:81096914-81096936 CGCTCCAGCTGTGGAGGAGGAGG + Intronic
1152708890 17:81860402-81860424 CGCCGACGCCCCCGAGGAGGAGG - Exonic
1153794403 18:8609497-8609519 GGCGGCAGCGGCGGAGGAGGAGG + Exonic
1153900605 18:9614495-9614517 CCGGGCGGCCGCGGAGGAGGGGG - Exonic
1153997472 18:10454642-10454664 CGCTGCAGCTGCGGTGGCGGTGG + Exonic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155519920 18:26657155-26657177 AGCGGCAGCCCCGGAGGAGGCGG + Intronic
1155654341 18:28177070-28177092 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1156275933 18:35582279-35582301 CGCTGCCCCCGAGGAGGACCCGG + Intronic
1156448568 18:37253990-37254012 CGCTGCCGGCGGGGAGGGGTCGG + Intronic
1157447531 18:47756444-47756466 GGCTGGGGCCGTGGAGGAGGGGG - Intergenic
1157763463 18:50281458-50281480 GGAGGCGGCCGCGGAGGAGGAGG - Exonic
1158695200 18:59697395-59697417 GGCGGCGGCCGCGGAGGAGCAGG - Intergenic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160356012 18:78229245-78229267 CACTGCAGCTGCGGAGGGGGCGG + Intergenic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160873174 19:1286092-1286114 GGCGGCGGCGGCGGAGGAGGCGG + Intergenic
1160930526 19:1567818-1567840 CGCTGGCGACACGGACGAGGAGG - Exonic
1160977851 19:1802529-1802551 TCCTGCAGCCTCGGAGGAGGAGG + Exonic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161400650 19:4065349-4065371 CGCTGCGGCCGGGGCGGGGGAGG - Intronic
1161454575 19:4363597-4363619 CGCTGCAGCAGGGGAGGTGGAGG - Intronic
1161897734 19:7095191-7095213 AGCTGCTGCAGCTGAGGAGGTGG - Intergenic
1161977695 19:7615496-7615518 GGCTCCAGCCGAGGAGGAGGTGG + Exonic
1162144443 19:8605253-8605275 CGCTGCCTCCGGGGAGGAGGTGG + Exonic
1162145594 19:8610911-8610933 CGCCCCCGCCGCGTGGGAGGGGG + Intergenic
1162802309 19:13118332-13118354 CGCGGAGGCCGCGGAGGCGGAGG + Exonic
1162916627 19:13877735-13877757 GGCCACCGCCGAGGAGGAGGAGG + Exonic
1163459018 19:17425146-17425168 AGCTGCAGCCCTGGAGGAGGGGG + Exonic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163607139 19:18281573-18281595 CGCTGCGGCCGCGGCCGGGGCGG - Exonic
1164498670 19:28793551-28793573 CTCGGGGGCCGCGGAGGAGGAGG - Intergenic
1164588360 19:29491790-29491812 ACCTGCCGCAGGGGAGGAGGTGG + Intergenic
1165157744 19:33798065-33798087 GGCTGGCTCCGCGGCGGAGGCGG + Intronic
1165426669 19:35749719-35749741 CGCTGGAGCCGGGGAGGCGGAGG + Intronic
1165803237 19:38565588-38565610 CGCTGGAGACGAGGAGGAGGCGG + Exonic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166882927 19:45940171-45940193 CGCTGCAGCCGCGGCCGGGGCGG - Exonic
1167237172 19:48322060-48322082 AGCAGCCGCCGCCGCGGAGGGGG - Intronic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1167649046 19:50719628-50719650 CGCGGCGGCCGCGGCGGAAGGGG - Intergenic
1167843417 19:52140106-52140128 CGGAGCCGCGGCGGAGGATGGGG + Intergenic
1167915181 19:52734640-52734662 CGCTCCCGGGGCTGAGGAGGGGG + Intronic
1168538543 19:57191779-57191801 CGTTGCCACCGAGGAGGCGGCGG + Exonic
1168643348 19:58044521-58044543 CGCGGCCGCCGCGGAGAAGGAGG + Intronic
927168768 2:20350947-20350969 CGCTGCCGCCGCGCGGGCCGGGG + Intronic
927181101 2:20447289-20447311 GGCTGCCGCGGCGGGGGCGGTGG - Exonic
927472321 2:23385566-23385588 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
927542744 2:23927214-23927236 CGCTGACGCCGCGCCGGGGGCGG - Intergenic
927652483 2:24920600-24920622 GGAAGCCGCGGCGGAGGAGGGGG - Intergenic
927887594 2:26728234-26728256 CGCTGCCGCCGTGGATGAGGCGG - Exonic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
928143577 2:28751841-28751863 CGGTGCCGAGGAGGAGGAGGTGG + Exonic
929701824 2:44169028-44169050 CGAGGCTGCGGCGGAGGAGGTGG + Exonic
931253396 2:60551861-60551883 CGCGGCAGCCCCGGAGCAGGCGG - Intronic
933666863 2:84971288-84971310 CGCTCCCGCGGCGGCGGCGGCGG - Exonic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
935196644 2:100820240-100820262 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
936446537 2:112600190-112600212 CTCTGCCGCCGACCAGGAGGTGG + Intergenic
938100161 2:128493062-128493084 CGGTGCGCCCGCGGAGGGGGCGG - Intergenic
938583753 2:132670041-132670063 CGCTGCTGCCGCGGAGACGACGG + Exonic
941603061 2:167563789-167563811 CGCTCCCTCCGGGGGGGAGGTGG - Intergenic
941686837 2:168456295-168456317 AGCAGCGGCCGCGGAGGAGGCGG + Exonic
942448369 2:176092967-176092989 CGCCGCCACCGATGAGGAGGAGG - Exonic
942448371 2:176092970-176092992 CGCCGCCGCCACCGATGAGGAGG - Exonic
942578663 2:177393008-177393030 CACTCCCGCCGCGCAGGAGTCGG + Exonic
943185317 2:184598927-184598949 GGCGGCTGCGGCGGAGGAGGCGG + Exonic
944933620 2:204545492-204545514 CGCGGGCGCCGCAGAGGAGTTGG + Intergenic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
948046839 2:234951898-234951920 AGCTGAGGCCGCGGAGGGGGTGG - Intergenic
948157965 2:235799933-235799955 CGCTGCCCTCGGGGTGGAGGTGG + Intronic
948487252 2:238288757-238288779 CTCGGCCGCGGCGGAGGCGGCGG - Intronic
1169244425 20:4015016-4015038 CGCTGCCCCCGCGTTGGCGGTGG - Intronic
1170999357 20:21397153-21397175 CGCGGCGGCCGCGGCGGCGGCGG - Exonic
1170999442 20:21397467-21397489 AGCTGCCGCGGCCGAGGTGGCGG - Exonic
1172275020 20:33674548-33674570 CGCGGCCACGGCGGAGGGGGAGG + Intergenic
1172974047 20:38893635-38893657 CTCGGCCGCAGCAGAGGAGGAGG + Intronic
1174386735 20:50191770-50191792 CGCGGCCCCCGCGTAGCAGGCGG - Exonic
1174607039 20:51768462-51768484 CGCCGCCCCGGGGGAGGAGGCGG + Exonic
1175429062 20:58890008-58890030 CGCTCGCGCCGCGGAAGAGCGGG + Intronic
1175521498 20:59605100-59605122 CCCGGCGTCCGCGGAGGAGGTGG - Exonic
1176093420 20:63328939-63328961 CGCTGCTGCCTCAGAGGAGGAGG - Intronic
1176549276 21:8214458-8214480 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1176557169 21:8258681-8258703 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1176568208 21:8397496-8397518 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1176576111 21:8441716-8441738 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1178513828 21:33229896-33229918 CGCCGCCGGCGCGGGGGCGGGGG - Intronic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1178914581 21:36699390-36699412 GGCGGCCGGCGCGGAGGCGGAGG - Exonic
1178975359 21:37216685-37216707 CACTGCGGACGCGGAGGGGGCGG - Intergenic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1179785695 21:43728537-43728559 CCCTGCCTCCCCGGAGGAGGAGG + Intronic
1179995997 21:44974647-44974669 CGCTGCAGCCCAGGAGGCGGAGG - Intronic
1180041204 21:45281160-45281182 CGCTTCTGCCGGGGAGCAGGGGG - Intronic
1180707372 22:17817918-17817940 CGCTGCAGCCACAGAAGAGGGGG - Exonic
1180831069 22:18906386-18906408 CGCGGGCGCCTTGGAGGAGGTGG + Exonic
1181068773 22:20319955-20319977 CGCGGCCGCCTTGGAGGAGGTGG - Exonic
1181618391 22:24070895-24070917 GGCTGCCGCCAAGGAGGAGTGGG + Exonic
1183517026 22:38272715-38272737 CGGTGCGGCCGCGGAGGGAGGGG - Intronic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1184533736 22:45072499-45072521 AGCTGCGGCGGGGGAGGAGGCGG - Intergenic
1184818899 22:46893774-46893796 CAGTGCTGCCGAGGAGGAGGAGG - Intronic
1185258596 22:49849547-49849569 CGCTGCCTCTGCGGAGAGGGAGG + Intergenic
1203254161 22_KI270733v1_random:130774-130796 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1203262217 22_KI270733v1_random:175853-175875 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1203281156 22_KI270734v1_random:131657-131679 CGCGGGCGCCTTGGAGGAGGTGG + Intergenic
950829362 3:15859433-15859455 AGCGGCAGCGGCGGAGGAGGAGG - Exonic
951078400 3:18424622-18424644 CGCTGCCTAGGCGGTGGAGGTGG - Intronic
951078572 3:18425349-18425371 GGCGGCGGCGGCGGAGGAGGAGG + Intronic
951907894 3:27721908-27721930 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
952908882 3:38165601-38165623 CGCTGCTGCTGCGGAGGCCGAGG + Exonic
953925341 3:46979799-46979821 GGCGGGCGGCGCGGAGGAGGCGG + Exonic
954408681 3:50359528-50359550 CGCTGCCGCCGGGGACGCGCAGG - Exonic
954539698 3:51385299-51385321 GGCGGCGGCAGCGGAGGAGGAGG + Exonic
955239341 3:57165363-57165385 CGCTGCCGCCGCGGCCGCCGCGG - Exonic
955916493 3:63912716-63912738 CGCTGGGGCTGCGGAGGCGGCGG - Exonic
956728700 3:72177488-72177510 CTCTGCGGCTGGGGAGGAGGAGG - Intergenic
959073407 3:101724977-101724999 CGCTCCCGATGCTGAGGAGGCGG + Intronic
960132804 3:114075590-114075612 CGCTTGAGCCGAGGAGGAGGAGG - Intronic
962164977 3:133038777-133038799 GGCTGGGGCCGAGGAGGAGGTGG + Intronic
963038381 3:141051397-141051419 GGCGGCGGCGGCGGAGGAGGGGG + Exonic
966362776 3:179148371-179148393 CGCTGCGGCCGCTGAGGTGTCGG + Intronic
966711944 3:182980513-182980535 CGCTGCGGAGCCGGAGGAGGAGG - Exonic
967118394 3:186361916-186361938 GGCGGCCGGCGCGGCGGAGGGGG - Intronic
967904097 3:194486786-194486808 CGCCGCGGGCGCGGAGGAGGAGG - Intronic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
968671778 4:1855989-1856011 CGCGGCCGCCGCGGAGAAGGAGG - Exonic
968701147 4:2058919-2058941 CCGGGCGGCCGCGGAGGAGGAGG + Intergenic
968701148 4:2058922-2058944 GGCGGCCGCGGAGGAGGAGGAGG + Intergenic
969021706 4:4143560-4143582 TGGGGACGCCGCGGAGGAGGAGG - Intergenic
969657219 4:8505270-8505292 GGCTGCAGCCCCTGAGGAGGTGG + Intergenic
969732161 4:8963855-8963877 TGGGGACGCCGCGGAGGAGGAGG + Intergenic
970194625 4:13542406-13542428 GGCAGGCGTCGCGGAGGAGGAGG - Exonic
975485751 4:74933059-74933081 CGCGGCGGCGGCGGCGGAGGCGG + Intergenic
975633041 4:76421113-76421135 CGGCGCCGCAGCCGAGGAGGAGG - Intronic
975701935 4:77075489-77075511 CTCTGCCGGGGAGGAGGAGGAGG - Exonic
975778977 4:77819655-77819677 TGCTGCGGCGGCGGGGGAGGCGG + Intergenic
975986254 4:80203226-80203248 CGCTGCAGCCGCGGCTGCGGCGG + Exonic
976389706 4:84496345-84496367 CGCTGCAGCCGAGGGGGAGAGGG + Intronic
978072625 4:104491557-104491579 CGCGGCGGCCGCGGCGGCGGCGG + Exonic
978443972 4:108763116-108763138 CGCGGCCCCGGCGGGGGAGGAGG - Intergenic
985301069 4:188490280-188490302 CGGTGCTGCAGCAGAGGAGGTGG + Intergenic
985504615 5:271850-271872 CGGGGCCGCCGCGGCGGAGGCGG - Intronic
986171701 5:5319664-5319686 CTCGGCCGCTGGGGAGGAGGAGG - Exonic
989229989 5:39074476-39074498 CGCCGTCGCCGCCGAGGGGGCGG - Intergenic
990955153 5:61332812-61332834 CGCCGCCGCCGCGGGGGCCGGGG + Exonic
992042445 5:72848741-72848763 GGCTTCCGGCGCGCAGGAGGCGG + Intronic
993900974 5:93584312-93584334 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
996518064 5:124395482-124395504 CCCTGCTGCCGCGGAGGCTGTGG - Intergenic
996862815 5:128084233-128084255 CGCTGCTGCGGCGGCGGCGGCGG + Exonic
997505229 5:134411815-134411837 GGCTGCCGCAGTGGAGGAGCTGG - Exonic
997653008 5:135536026-135536048 GGCTGCCGCGGGGGCGGAGGTGG - Intergenic
997965478 5:138352872-138352894 CGCTGCCGCCGCGGGAGCCGAGG - Exonic
998166674 5:139848287-139848309 CGCGGCCGCGGCGGCGGCGGGGG + Exonic
999322688 5:150624982-150625004 CGGCGCCGCCCAGGAGGAGGTGG + Intronic
999326939 5:150649598-150649620 CCCCGCGGCGGCGGAGGAGGTGG + Exonic
1002532792 5:179858683-179858705 CGCTGTCCCCGCGCCGGAGGAGG + Intronic
1002600820 5:180353166-180353188 CGCGGACGGCGTGGAGGAGGCGG + Intronic
1003173340 6:3737272-3737294 GGCTGCCTCTGCGGAGGAGCGGG - Intronic
1003240895 6:4344760-4344782 TGCTGCCCCCACGGAGGAAGAGG - Intergenic
1003379445 6:5609995-5610017 CTATGCCACTGCGGAGGAGGTGG - Intronic
1004864279 6:19837868-19837890 CGCAGCCGCGGCGGCGGCGGCGG + Exonic
1006472664 6:34237337-34237359 CGCGGCGGCGGCGGCGGAGGGGG + Intronic
1007378226 6:41470590-41470612 CGCTGGCGCCCCGGAGACGGCGG - Intergenic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1009437624 6:63636071-63636093 CGCCGCCGAAGAGGAGGAGGAGG - Exonic
1009437626 6:63636074-63636096 TGCCGCCGCCGAAGAGGAGGAGG - Exonic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1011470254 6:87701517-87701539 GGCGGCCGCAGCGGAGAAGGAGG + Exonic
1011517130 6:88166586-88166608 CGCGGCGGCGGAGGAGGAGGAGG - Intergenic
1011640352 6:89411936-89411958 CGAGGACGACGCGGAGGAGGAGG - Exonic
1013507592 6:110815339-110815361 CGCCGTCGCGGAGGAGGAGGAGG - Intronic
1013507594 6:110815342-110815364 CGCCGCCGTCGCGGAGGAGGAGG - Intronic
1013507596 6:110815345-110815367 CGCCGCCGCCGTCGCGGAGGAGG - Intronic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1015799210 6:137044240-137044262 CGCGGCCGCGGCGGTGGTGGCGG + Intronic
1015935642 6:138404223-138404245 CCCTGTCGCCGCGGAGGGGCGGG + Exonic
1016923498 6:149317972-149317994 GGCGGCGGCCGAGGAGGAGGAGG + Intronic
1016936981 6:149454904-149454926 CCCTGCAGCCGTGGAGGTGGAGG - Intronic
1017672067 6:156778039-156778061 TGCCGCCGCGGAGGAGGAGGAGG - Exonic
1017672068 6:156778042-156778064 CGCTGCCGCCGCGGAGGAGGAGG - Exonic
1017672070 6:156778045-156778067 CGCCGCTGCCGCCGCGGAGGAGG - Exonic
1017672288 6:156778860-156778882 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1019262393 7:88764-88786 GGCTGCAGCCGCGGAGGTGGGGG - Intergenic
1019298222 7:290105-290127 GGCGGGCGGCGCGGAGGAGGCGG + Intergenic
1019421802 7:954275-954297 CGCGGACGCCGCGGGGGTGGCGG - Intronic
1019564352 7:1672049-1672071 TGCTGCGGCCGAGGAGGAGGGGG - Intergenic
1019568237 7:1695302-1695324 AGCTGCAGCCCTGGAGGAGGAGG - Intronic
1020035017 7:4959309-4959331 CGCCGCCTCCGCTGAGGTGGAGG + Intergenic
1022114675 7:27251659-27251681 CGCTGCCTGCGCGAGGGAGGCGG - Intergenic
1022697866 7:32728165-32728187 AGCGGCCGCCGGAGAGGAGGCGG + Intergenic
1023417972 7:39950143-39950165 CGTCGACGCCGAGGAGGAGGCGG + Exonic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025615707 7:63114421-63114443 CGCTGCCGCGGCGGCGGCGGCGG + Intergenic
1025739056 7:64182058-64182080 CGCTGCGGGGGCGGAGGCGGAGG - Intronic
1025899414 7:65731851-65731873 CGCTGAGCCCCCGGAGGAGGAGG - Intergenic
1026949589 7:74338478-74338500 AGCTGCGGCCGGGGAGGAGGAGG - Exonic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1029461027 7:100694029-100694051 CGCGGCCGCCGCGGCGTCGGGGG + Intergenic
1029640255 7:101815897-101815919 CGCCGCCGCCACCGAGGACGCGG - Intronic
1030176456 7:106660302-106660324 CGCTGCCGACGCGGATGGTGGGG + Exonic
1031317370 7:120273808-120273830 TGCTGCCGCCACGGCGGCGGCGG + Exonic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1034342770 7:150368842-150368864 CGCTGTCGCCGCGGCGGGGCGGG + Exonic
1034470512 7:151252033-151252055 CGCGGCGGCCGGGGAGGCGGCGG + Intronic
1035341621 7:158166299-158166321 CGCGGCGGCCGGGGGGGAGGAGG - Intronic
1035751846 8:2002050-2002072 CGCGGCCGGCGCGCAGGCGGCGG - Exonic
1038003509 8:23410518-23410540 CGCTGCTTCCTCGGAGGAGGCGG - Intronic
1038722194 8:30047097-30047119 CGCTGGAACCCCGGAGGAGGAGG - Intergenic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1040457450 8:47612890-47612912 CACTGCCGCCACGGAGGAAATGG + Intronic
1042040198 8:64581351-64581373 CGCTGGCGCCGCCGTGGAGGTGG - Exonic
1044115265 8:88327574-88327596 GGCGGCGGCGGCGGAGGAGGAGG - Intronic
1044973776 8:97644338-97644360 CGCTGCCACCGCGGGGAGGGCGG - Exonic
1046103905 8:109644691-109644713 CGCTGCCGCCGTCCAGGAGGAGG + Exonic
1047381888 8:124372125-124372147 TGCTGCCGCTGCTGAGGAGCCGG - Exonic
1047998401 8:130357958-130357980 CGCTGCCGCCGCGCAGCTGGAGG - Intronic
1048072986 8:131040792-131040814 CCCTGCAGCCGCGGAGCAGTGGG - Exonic
1048980890 8:139703081-139703103 GGCGGCGGCGGCGGAGGAGGAGG - Intergenic
1049227039 8:141459260-141459282 CTATGCTGCTGCGGAGGAGGTGG + Intergenic
1049548570 8:143246223-143246245 CGTGGGCGCCGCGGAGGCGGGGG + Intergenic
1049687274 8:143944024-143944046 GGCTGCCGCCGCGTATGGGGCGG - Intronic
1049766874 8:144358997-144359019 CGCTGCGGCCCCAGGGGAGGAGG - Exonic
1050472388 9:6007445-6007467 CGTTGCCACCGCGGAGGAGGAGG - Exonic
1051079690 9:13279657-13279679 CGGGGCTGCCGCGGAGGCGGTGG + Intergenic
1051287300 9:15510463-15510485 CGCTGCCTCCGCGCTGGAGCAGG + Intronic
1056900813 9:90597540-90597562 CAGTCCCGCAGCGGAGGAGGAGG + Intergenic
1057208133 9:93185207-93185229 CGCTGCGGGCGCGGGGGCGGCGG - Exonic
1057259553 9:93576333-93576355 CGCTCCCGCCGCCGGGAAGGCGG - Intergenic
1057361148 9:94374755-94374777 CGGCGACGCCGCGGAGGCGGCGG - Exonic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1057662213 9:97013409-97013431 CGGCGACGCCGCGGAGGCGGCGG + Exonic
1057773157 9:97984458-97984480 CGCCGCCGCCGCGGCACAGGGGG - Intronic
1057876022 9:98755227-98755249 CGCTGCAGCTGCTGAGGAGTAGG - Intronic
1057904650 9:98974548-98974570 TGCTGCAGGCGCAGAGGAGGGGG + Intronic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1059510896 9:114845554-114845576 CGCTGCCGCTGTGGTGGTGGTGG - Intergenic
1060485862 9:124045764-124045786 GGCTGCCAGCGCGGGGGAGGCGG + Intergenic
1061419012 9:130463324-130463346 CACTGATGCCGAGGAGGAGGAGG - Intronic
1062381198 9:136287587-136287609 GGGTGCCGCAGCCGAGGAGGTGG - Intronic
1062537625 9:137027882-137027904 CGCTGCGGCCTCCGGGGAGGTGG - Exonic
1203770909 EBV:49655-49677 GGCTGCGGCGGCGGAGGCGGCGG - Intergenic
1203470562 Un_GL000220v1:113918-113940 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1203478383 Un_GL000220v1:157890-157912 CGCCCCCTCCGGGGAGGAGGAGG - Intergenic
1186638130 X:11427754-11427776 CGCTGCCGCTGCGGAGCCGGTGG + Intronic
1189005106 X:36986372-36986394 AGCTGCGGCGGCGCAGGAGGGGG - Intergenic
1189043915 X:37571570-37571592 AGCTGCGGCGGCGCAGGAGGGGG + Intronic
1190008041 X:46758886-46758908 CGCCGCCGCCCCAGAGGAGGAGG + Exonic
1190225224 X:48539869-48539891 GGCGGCGGCCGCTGAGGAGGAGG + Exonic
1192657113 X:73003459-73003481 CGCCGCCGCAGCGGAGGCTGCGG + Intergenic
1192665007 X:73079542-73079564 CGCCGCCGCAGCGGAGGCTGCGG - Intergenic
1193819819 X:86148313-86148335 GGCTGCCGCTGGTGAGGAGGTGG - Intergenic
1195668360 X:107449941-107449963 CGCTGAGGAGGCGGAGGAGGAGG + Intergenic
1197147245 X:123184362-123184384 GGCGGCGGCAGCGGAGGAGGAGG + Exonic
1198767197 X:140091688-140091710 AGCGGCGGCGGCGGAGGAGGAGG + Intergenic
1198807148 X:140503984-140504006 AGCTGCGGCCGCGGCGGTGGCGG + Exonic
1199772396 X:150983435-150983457 CGCTGCGGCGGCGGCGGCGGCGG - Intronic
1200100655 X:153687995-153688017 CGCCGCCGCCGGGAAGGAGAGGG + Intronic
1200626643 Y:5525310-5525332 AGCAGCAGCAGCGGAGGAGGAGG + Intronic