ID: 1017673706

View in Genome Browser
Species Human (GRCh38)
Location 6:156793103-156793125
Sequence ATCTGATATTAGGGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017673706_1017673720 22 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673720 6:156793148-156793170 GGCATGGCTGGCACCTGAGAAGG 0: 1
1: 0
2: 2
3: 30
4: 273
1017673706_1017673714 -7 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673714 6:156793119-156793141 ATCAGATTAATACCGGGGTGGGG No data
1017673706_1017673712 -9 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673712 6:156793117-156793139 ATATCAGATTAATACCGGGGTGG No data
1017673706_1017673715 -6 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673715 6:156793120-156793142 TCAGATTAATACCGGGGTGGGGG No data
1017673706_1017673718 6 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673718 6:156793132-156793154 CGGGGTGGGGGCATGAGGCATGG No data
1017673706_1017673713 -8 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673713 6:156793118-156793140 TATCAGATTAATACCGGGGTGGG No data
1017673706_1017673719 10 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673719 6:156793136-156793158 GTGGGGGCATGAGGCATGGCTGG No data
1017673706_1017673716 1 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673716 6:156793127-156793149 AATACCGGGGTGGGGGCATGAGG 0: 1
1: 0
2: 1
3: 4
4: 209
1017673706_1017673722 30 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673722 6:156793156-156793178 TGGCACCTGAGAAGGCAAAAGGG 0: 1
1: 0
2: 1
3: 27
4: 367
1017673706_1017673721 29 Left 1017673706 6:156793103-156793125 CCAGCACAGCCCTAATATCAGAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1017673721 6:156793155-156793177 CTGGCACCTGAGAAGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017673706 Original CRISPR ATCTGATATTAGGGCTGTGC TGG (reversed) Intronic
900413447 1:2524126-2524148 ATCTGATTTTAGGTTTCTGCGGG - Intronic
902416209 1:16241188-16241210 ATCTGAGAGCAGGGCTGTCCTGG + Intergenic
902577598 1:17388287-17388309 ATCTGATATGAGGAATGAGCTGG + Intronic
904855819 1:33497500-33497522 AGCTGATATTAGAGGAGTGCTGG + Intergenic
909464460 1:75957789-75957811 ATCTAATATAAGGGCAGTCCAGG + Intergenic
914862906 1:151400924-151400946 TTCTGATATGAGGGATGGGCTGG + Intronic
917811480 1:178662647-178662669 AGGTGACATTAGAGCTGTGCTGG + Intergenic
921289384 1:213642124-213642146 ATCTGAAATGAGCACTGTGCTGG - Intergenic
921556655 1:216606593-216606615 ATCTGATAATTGGGTTGTGGGGG - Intronic
923814181 1:237357343-237357365 TGCTGATATTAGGGAAGTGCAGG - Intronic
924010768 1:239663127-239663149 CTCTGATGTTAGGGCTGAGGAGG + Intronic
924456470 1:244222826-244222848 ATTTGAGATCAGGGCTGTCCTGG - Intergenic
924718928 1:246605407-246605429 AACTGATATTAGAGCCTTGCAGG - Intronic
1064707866 10:18091420-18091442 CTCTGAGCTCAGGGCTGTGCTGG + Intergenic
1066244299 10:33567553-33567575 ATCTATTATTAGGCCTGGGCAGG + Intergenic
1067286465 10:44911180-44911202 ATCGGCGATTAGGGCTGGGCTGG - Exonic
1067904242 10:50274146-50274168 ACCTCATATTAGGGTAGTGCTGG - Intergenic
1069155481 10:65024730-65024752 ATTTGATAATAGGGCAATGCTGG + Intergenic
1074272237 10:111965494-111965516 AACTGAAATTAAGGCTGTTCAGG + Intergenic
1078115962 11:8450664-8450686 TTCTGATGTTAGGGTTATGCTGG - Intronic
1080820061 11:35797052-35797074 ATCTGATTTTAGGTCTGGGGAGG + Intronic
1088733235 11:112702834-112702856 TTTTGATATTAGGGTGGTGCTGG - Intergenic
1090095605 11:123739856-123739878 TTCTGGTAATAGGTCTGTGCTGG - Intronic
1091915086 12:4266412-4266434 ATCATGGATTAGGGCTGTGCAGG - Intergenic
1092030757 12:5282434-5282456 ATCTTATACTAGTGTTGTGCTGG - Intergenic
1092469945 12:8768534-8768556 ATTTGATATTAAGGTTATGCTGG + Intronic
1092745457 12:11668487-11668509 ATGTGAGATTAGGGCTGTAGAGG + Intronic
1093115241 12:15201798-15201820 ATCTTATATTAGGGCTTTTATGG - Intronic
1093893689 12:24553333-24553355 ATCTGATAGGAGGGCTGGGAGGG + Intergenic
1098282703 12:68877830-68877852 ATCTGAAATTATGGCCGTTCTGG - Intronic
1099749656 12:86756645-86756667 ATCTGTTATTACAGTTGTGCTGG - Intronic
1100172989 12:91998520-91998542 TTTTGGTATTAGGGTTGTGCTGG - Intronic
1103735334 12:123057544-123057566 ATCTGAAATCAGAGCTGGGCGGG + Intronic
1105984590 13:25553036-25553058 AACTGATATTAAAGCTGTGAAGG - Intronic
1117917758 14:60696056-60696078 GTCTGGTATCAGGGTTGTGCTGG + Intergenic
1118061730 14:62146065-62146087 TTCTGCTATTATGGCTCTGCTGG - Intergenic
1118778784 14:68992221-68992243 ATCTGTTATTGAGGCTGTGAAGG + Intergenic
1119335893 14:73833497-73833519 TTTGGATATTAGGGCTTTGCTGG + Intergenic
1121864354 14:97348488-97348510 ACCTGATACTAGGGCTGGGAGGG + Intergenic
1123443376 15:20305261-20305283 AGCTGGTACTAGGGCTGAGCCGG + Intergenic
1124386002 15:29208536-29208558 ATCTGATATCTGTGGTGTGCTGG - Intronic
1125116274 15:36095701-36095723 TTTTGATATTAGGGCAGTGCTGG - Intergenic
1127663908 15:61125776-61125798 ATTTGATATTAGGGCTTTGGTGG - Intronic
1128433158 15:67619224-67619246 ATTTGATATTAGGGTTGGGGAGG - Intronic
1129623161 15:77168367-77168389 ATCTGATATTATGGCTTACCAGG + Intronic
1132304057 15:100796807-100796829 ATTTGGTATTAGGGTTGTGCTGG - Intergenic
1132523703 16:403505-403527 ATTTGATATTAGTGCCATGCAGG + Intronic
1132595134 16:745759-745781 ACCTGAAATGAGGGCTGTGGTGG - Intronic
1135426388 16:22340403-22340425 ATTTGATATCAGGGTAGTGCTGG - Intergenic
1136490136 16:30602419-30602441 ACCTGGTAATAGGGCTCTGCTGG + Intergenic
1139953238 16:70681811-70681833 ATCTGATTTTGGGGCTTTTCTGG + Intronic
1141939793 16:87267447-87267469 TCCAGGTATTAGGGCTGTGCTGG + Intronic
1144816393 17:18038652-18038674 AATTGATATTTGGCCTGTGCAGG - Intronic
1153227584 18:2910110-2910132 AGCAGTTATGAGGGCTGTGCCGG + Intronic
1153698376 18:7666909-7666931 ATCTTATTTTAGGGCTGGCCTGG + Intronic
1162831991 19:13291011-13291033 AATTGATATTAGGCCTCTGCAGG - Intronic
1165005121 19:32798749-32798771 TTCTGAAACTATGGCTGTGCAGG - Intronic
927651211 2:24914789-24914811 ATCTGACACTCAGGCTGTGCTGG - Intronic
929108808 2:38389105-38389127 ACCTGGTAGTAGGGTTGTGCTGG + Intergenic
932126098 2:69146756-69146778 ATCTGAGATGAGGCCTGGGCAGG + Intronic
937688719 2:124728268-124728290 CTTTGATATTAGGGCAATGCTGG + Intronic
940411999 2:153375949-153375971 AGCTGATATTGGGGCTGGCCTGG + Intergenic
941266856 2:163373104-163373126 ATAAGATATTATGGCTATGCAGG + Intergenic
943796338 2:192001281-192001303 ATAAGATATTAGGGCTTTGACGG + Intronic
944202837 2:197126253-197126275 ATTTGATTTTAGAGATGTGCCGG - Intronic
947759701 2:232594894-232594916 AGCTGATTATAGGGCTGGGCAGG + Intergenic
1174910590 20:54603674-54603696 CTTTGTTATTAGGGCTGTCCTGG - Intronic
952049529 3:29366731-29366753 ATTTGCTATTCGGGCTGTACAGG - Intronic
954251461 3:49370858-49370880 AACTGAAATTTGGGCTGTGAAGG - Intronic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
960621839 3:119644711-119644733 CTCTCATATAAGTGCTGTGCCGG + Intronic
962122885 3:132582581-132582603 ATCTAATCTGAGGGCTGTGGAGG + Intronic
962696153 3:137949300-137949322 ATCTGAAATTATGCCTGTGCTGG + Intergenic
970689629 4:18607606-18607628 ATCAAATATTAGTGCTGTCCAGG + Intergenic
972219014 4:36932406-36932428 ATCTGATATTAGAGTAATGCTGG - Intergenic
973772480 4:54219445-54219467 TTCTTATCTTAGGGCTGTGAGGG + Intronic
978945451 4:114490591-114490613 ATCTGCTCCTAGGGCTGTGCTGG - Intergenic
979802926 4:124934022-124934044 ATCTCATGTTAGCGCTGTCCTGG - Intergenic
981781573 4:148436584-148436606 ATCTGATATTAAAACTGAGCTGG - Exonic
984762373 4:183373950-183373972 TTTGGATATTAGGGCTATGCTGG + Intergenic
986629802 5:9760349-9760371 TTTTGATATTAGGGCAATGCTGG - Intergenic
987659578 5:20855091-20855113 AGCTTCTATTAGGGCAGTGCAGG + Intergenic
988176655 5:27735204-27735226 CTCTGAAGTTAGTGCTGTGCTGG + Intergenic
988764066 5:34350556-34350578 AGCTTCTATTAGGGCAGTGCAGG - Intergenic
1006115648 6:31774803-31774825 GTTTGAAACTAGGGCTGTGCTGG + Intronic
1006467624 6:34205446-34205468 ATCTGATATTAGTGCAATGTTGG - Intergenic
1011219571 6:85039942-85039964 AACAAATATTAGGACTGTGCTGG + Intergenic
1013481576 6:110557541-110557563 GTCTGATATCAGGGCTGTTGGGG + Intergenic
1015393822 6:132713439-132713461 ATGTGCTATTAAGGCTTTGCAGG - Intronic
1016657223 6:146534152-146534174 AACTGATATTAGGGTAATGCTGG - Intergenic
1017673706 6:156793103-156793125 ATCTGATATTAGGGCTGTGCTGG - Intronic
1023642484 7:42273880-42273902 CGCTGAGATTAGGGCTGTGGGGG - Intergenic
1028625571 7:92872998-92873020 AACTGATATTAGGGATTAGCAGG - Intergenic
1045793039 8:106008824-106008846 ATCTGATATTAGGACTGATATGG - Intergenic
1048088984 8:131218216-131218238 TTCAGAGTTTAGGGCTGTGCAGG + Intergenic
1048735579 8:137497209-137497231 ATTTGGTATTAGGGTTGTGCTGG + Intergenic
1050153024 9:2636006-2636028 ATCTGATCTTTGATCTGTGCTGG - Intronic
1052336689 9:27327330-27327352 TTCTGATATTAGGACTGATCAGG - Exonic
1056813565 9:89782997-89783019 ATCTCTTACTAGTGCTGTGCAGG - Intergenic
1057105456 9:92410952-92410974 ATCTGATATAAGAGCTATGTGGG - Intronic
1059722421 9:116974222-116974244 ATCTGATCTTAGCACTGTTCTGG - Intronic
1185924627 X:4132600-4132622 ACCTGATATTGGGGATGTGATGG + Intergenic
1188444260 X:30240084-30240106 ATCTGATCTCAGGGAGGTGCAGG + Intergenic
1189283746 X:39837553-39837575 ATCTGCAATTTGGGCTGGGCTGG + Intergenic
1192977288 X:76299918-76299940 ATCTGAGATTGCTGCTGTGCTGG + Intergenic
1196157712 X:112449236-112449258 ATCTGCTCTTAGGGCTCTGTGGG - Intergenic
1197735607 X:129848616-129848638 GTCAGAGACTAGGGCTGTGCCGG - Intergenic