ID: 1017674021

View in Genome Browser
Species Human (GRCh38)
Location 6:156795329-156795351
Sequence GAGAATAAGGGAAGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1878
Summary {0: 1, 1: 1, 2: 10, 3: 189, 4: 1677}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017674015_1017674021 -6 Left 1017674015 6:156795312-156795334 CCGAGGAAGTGGGAAGAGAGAAT 0: 1
1: 0
2: 4
3: 43
4: 427
Right 1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG 0: 1
1: 1
2: 10
3: 189
4: 1677
1017674011_1017674021 10 Left 1017674011 6:156795296-156795318 CCAGAAATCCATGAGTCCGAGGA 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG 0: 1
1: 1
2: 10
3: 189
4: 1677
1017674014_1017674021 2 Left 1017674014 6:156795304-156795326 CCATGAGTCCGAGGAAGTGGGAA 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG 0: 1
1: 1
2: 10
3: 189
4: 1677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017674021 Original CRISPR GAGAATAAGGGAAGGGAGGC CGG Intronic
900017392 1:162190-162212 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
900047651 1:520786-520808 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
900084934 1:888319-888341 GAGAAGAAAGGAAGGCAGGAAGG + Intergenic
900308259 1:2021434-2021456 GAGACTGAGGGAAGGGAGGGCGG - Intronic
900725536 1:4214149-4214171 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
900864723 1:5260222-5260244 GAGAAGAGGGGCAGGGACGCTGG - Intergenic
900892310 1:5458381-5458403 GGGAAGGAGGGAAGGGAGGAAGG - Intergenic
900918497 1:5655808-5655830 GAGAAGAAAGGAAGGCAGGAGGG + Intergenic
901078772 1:6571893-6571915 GGGAAGAAGGAAAGGCAGGCAGG - Intronic
901125646 1:6926679-6926701 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
901174296 1:7287466-7287488 GAGAAGAAGGAAAGGGAGAAAGG - Intronic
901215240 1:7551197-7551219 GAGAAGCAAGGAAGGGAGGAGGG + Intronic
901218188 1:7566492-7566514 GGGAAGAAAGGAAGCGAGGCAGG - Intronic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901472931 1:9470271-9470293 GAAAAGAACGGAAGGAAGGCAGG + Intergenic
901751586 1:11413514-11413536 GAAAATAAAGGAAGGGTGGTGGG - Intergenic
901938570 1:12644934-12644956 GAGAAGGAGGGAAGGAAGGGAGG - Intronic
901938604 1:12645061-12645083 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
901961440 1:12829364-12829386 GAGAATGAGAGAAGGGAGGCAGG - Intronic
901968028 1:12883971-12883993 GAGAATGAGAGAAGGGAGGCAGG - Intronic
901975840 1:12943129-12943151 GAGAATGAGAGAAGGGATGCAGG - Intronic
901983429 1:13054236-13054258 GAGAATGAGAGAAGGGATGCAGG - Intronic
901985577 1:13073099-13073121 GAGAATGAGAGAAGGGATGCAGG + Intronic
901996232 1:13153668-13153690 GAGAATGAGAGAAGGGATGCAGG - Intergenic
901998660 1:13174682-13174704 GAGAATGAGAGAAGGGATGCAGG + Intergenic
902009334 1:13258636-13258658 GAGAATGAGAGAAGGGATGCAGG + Intronic
902017148 1:13317809-13317831 GAGAATGAGAGAAGGGAGGCAGG + Intronic
902147493 1:14415761-14415783 GGGAAGTAGGGAAGGGAGTCAGG - Intergenic
902270463 1:15300789-15300811 GAAAGTAAGGGCAGGCAGGCAGG - Intronic
902446208 1:16466242-16466264 AAAAAAATGGGAAGGGAGGCCGG + Intergenic
902759016 1:18568725-18568747 GAGAAGGAGGGAAGGGAGGAAGG + Intergenic
902927138 1:19703473-19703495 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
902933520 1:19747619-19747641 GGGAAGAAGGGAGGGGAGGAGGG - Intronic
902969293 1:20034956-20034978 GAGAATGAGGGAAGGGGGCTGGG + Intronic
903813847 1:26050195-26050217 GAGAATAAGGGACCAGAGACAGG - Intergenic
904073085 1:27816952-27816974 GAGAAAGAAGGAAGGGAGGGAGG + Intronic
904482039 1:30800193-30800215 GAGAAGGAAGGAAGGCAGGCTGG + Intergenic
904759360 1:32790543-32790565 GAGAGAAAGGGAAGGAAGGAAGG + Intronic
904896968 1:33824784-33824806 GAGAAAAAGTGAAGGGAGAGAGG + Intronic
904978153 1:34474263-34474285 GAGGAGAGGGGAAGGGAGGGAGG - Intergenic
904982985 1:34522417-34522439 GAGAATAGCAGAAGGGATGCAGG + Intergenic
905137891 1:35814112-35814134 GAGAAAAAAGGAAGGAAGGAAGG + Intronic
905282781 1:36859782-36859804 GAGAAGAAAAGAAGGGAGGCAGG + Intronic
905314156 1:37070420-37070442 GAGGACAAGGGAAGGGAGATTGG - Intergenic
905318422 1:37098272-37098294 GAGGATTAGGGAAGAGAGGCAGG - Intergenic
905752626 1:40479069-40479091 GAGCAAAAGGGAAGGGAAGAGGG - Exonic
905848999 1:41258900-41258922 GAGAATATGTAAAGGGAGGGAGG + Intergenic
905942321 1:41873957-41873979 GAGGAGAAGGGAAGCGAGGGTGG - Intronic
906146163 1:43561909-43561931 GAGTATAGGGGCAGGGGGGCAGG - Intronic
906148762 1:43575626-43575648 GAGAATCAGGGAGGTGAGTCAGG - Intronic
906200692 1:43958351-43958373 GAGAATAAGGGATAAGAGGAAGG - Intronic
906694840 1:47817073-47817095 GGGAAAAAGGGAATGGAGGAAGG + Intronic
906773381 1:48505614-48505636 GGGAGGAAGGGAAGGGAGACTGG + Intergenic
906866830 1:49430281-49430303 GGGAATCAGAGAAGGGAGCCTGG - Intronic
906884700 1:49631690-49631712 AAGACTAAGGGAAAGGAAGCAGG + Intronic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907038059 1:51234377-51234399 GAGAGAGAGAGAAGGGAGGCAGG - Intergenic
907155254 1:52327675-52327697 GAAGAAAAGGGAAGGTAGGCCGG + Intronic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907360758 1:53912622-53912644 GAGAAGATGGGAAGGGAGAAGGG + Intergenic
907430623 1:54409191-54409213 TAGAAGAAGGGAACTGAGGCAGG - Intronic
907745171 1:57206206-57206228 GAGGAGAAGAGGAGGGAGGCAGG + Intronic
908022778 1:59915542-59915564 GAGAATAAGGAAATAGAGACAGG + Intronic
908174539 1:61541419-61541441 TAGGATAGAGGAAGGGAGGCTGG + Intergenic
908218357 1:61978243-61978265 AAGAATAAAGGAAGGAAGGAGGG - Intronic
908650518 1:66328259-66328281 GAGAGCAAGAGAAGGGAGGTTGG + Intronic
909776984 1:79493804-79493826 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
910049040 1:82955605-82955627 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
910280891 1:85500271-85500293 GAGAAAATGGGAAGGGAAGAAGG - Intronic
910476596 1:87614458-87614480 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
910778443 1:90899921-90899943 AAGAAAAAAGGAAGGGAGGGAGG + Intergenic
911042473 1:93601797-93601819 GAGGAGAAGGGAGAGGAGGCTGG + Intronic
911065981 1:93788971-93788993 AAAAATAAAGGAAGGGAGGGAGG - Intronic
911070412 1:93827717-93827739 GAGAGGAAGAGAAGGGAGGAGGG + Intronic
911094424 1:94044129-94044151 GAAAAAAAAGGAAGGGAGGAAGG - Intronic
911254139 1:95614825-95614847 AAGAATGAGAGAAGGGAGGAAGG - Intergenic
911448580 1:98034133-98034155 GAGAAGAAAGGAAGGGAGAAAGG + Intergenic
911713925 1:101109129-101109151 TAGCAAAAGGGAAGGGAGGAAGG - Intergenic
911720544 1:101186760-101186782 GAGAAAAAGAGGAGGGAGGGAGG - Intergenic
911856497 1:102884168-102884190 GAGAATGAGGGATGAGAGACAGG - Intronic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
911939578 1:104024610-104024632 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912447618 1:109750021-109750043 GAGACCAAAGGCAGGGAGGCAGG - Intronic
912499405 1:110112208-110112230 GAGACTAGGGAAAGGGAGGGAGG - Intergenic
912521601 1:110249334-110249356 CACAATAAGGGATGGCAGGCTGG + Intronic
912612999 1:111067693-111067715 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
912723029 1:112035833-112035855 GAGAATAAAGGGAGGAAGGATGG - Intergenic
912752794 1:112299404-112299426 GGGGATAAGAGAAGAGAGGCAGG + Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
913120179 1:115732781-115732803 GAGAAAGAGGCAAGGGAGGATGG + Intronic
913341352 1:117760564-117760586 GAGAAGAAGGGAGGAGAGGCTGG + Intergenic
913359542 1:117964557-117964579 GAGAAAAAGGGAGGGGAGGAAGG + Exonic
913601032 1:120421354-120421376 GAGAAGTAGGGAAGGAAGGAAGG - Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914086020 1:144455275-144455297 GAGAAGTAGGGAAGGAAGGAAGG + Intronic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914191916 1:145419234-145419256 GAGAAGTAGGGAAGGAAGGAAGG + Intergenic
914452544 1:147805601-147805623 GAGTATAAGGGAAAGAAGGCGGG + Intergenic
914589820 1:149097180-149097202 GAGAAGTAGGGAAGGAAGGAAGG + Intronic
914814396 1:151052891-151052913 GAGGAGAAGGGCAGGGAGGTAGG + Exonic
914956606 1:152168213-152168235 GAGAAGAGGGGATGGGAGGATGG + Intergenic
915034189 1:152908838-152908860 GAGAATTATGGAAGGGAGGAGGG + Intronic
915301624 1:154954913-154954935 CAGGAAAAGGGAAGTGAGGCTGG + Intronic
915558936 1:156675471-156675493 GGGAATAGGGTAGGGGAGGCGGG - Intronic
915606430 1:156954763-156954785 GAGAAGAAAGAAAGGGAGGGAGG + Intronic
915907230 1:159887774-159887796 GGGAATAAGGGGAGGGCGGAGGG + Intronic
915970838 1:160354080-160354102 GAGATTAACTGATGGGAGGCTGG - Intronic
916055284 1:161064943-161064965 GGGAAGAAGGGAAGGGAAGGGGG + Intronic
916376799 1:164163715-164163737 GAGAATAATGGAAGATAGACTGG - Intergenic
916462608 1:165042271-165042293 GGGAGTAAGGGAAGGGGTGCTGG + Intergenic
916522794 1:165580277-165580299 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916701320 1:167298865-167298887 TAGAATTATGGAAGGAAGGCTGG + Intronic
916723498 1:167503022-167503044 AAGAACATGGGAAGTGAGGCAGG + Intronic
916861527 1:168811072-168811094 AAGAATAGTGGAAGGCAGGCAGG - Intergenic
917036063 1:170748174-170748196 GAGTAGGAGGGAAGGGAGGGAGG - Intergenic
917336126 1:173926086-173926108 GAGAAACAGCAAAGGGAGGCTGG + Intergenic
917380937 1:174407346-174407368 GACAATTAAGAAAGGGAGGCAGG - Intronic
917411262 1:174762113-174762135 GAGAGTGAGGGAAGGGCGGTAGG + Intronic
917455775 1:175184387-175184409 GAGAAGAAGGGTAGGGAGTGGGG - Intronic
917482878 1:175427693-175427715 GGGAAGAAGGGAAGGAAGGAAGG - Intronic
917482888 1:175427742-175427764 GGGAAGAAGGGAAGGAAGGAAGG - Intronic
917536758 1:175879769-175879791 GAGAAAAAGGGAAGGAGGACAGG - Intergenic
917758723 1:178132030-178132052 GAGAAAGAGGGAAGGGAAGAAGG - Intronic
918302886 1:183220127-183220149 GAGAAGAAGGCAGGGGAAGCTGG - Intronic
918522963 1:185434992-185435014 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
918895347 1:190336785-190336807 GTGAAGGAGGGAAGGGAGGGAGG - Intronic
919078008 1:192836012-192836034 TAGAAGAGGGGAAGGCAGGCGGG + Intergenic
919274923 1:195401456-195401478 AAGAAAAAAGGAAGGGAGGAAGG + Intergenic
919503613 1:198369615-198369637 GAGGAGAAGGGAAGACAGGCTGG - Intergenic
919530847 1:198717801-198717823 GAGAAAAAGGGAAGGGAGTGGGG - Intronic
919563946 1:199160538-199160560 GAGAAAGAGGGTAGGGAGGAAGG - Intergenic
919588227 1:199465547-199465569 GAGAATGAAGGAAGAGAGACAGG + Intergenic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
919777344 1:201202764-201202786 GAGAAGAAAGGAAGGAAGGAAGG - Intronic
919884181 1:201920730-201920752 TAGAATAGGGGGTGGGAGGCTGG + Intronic
920033809 1:203052734-203052756 GAGAAGGAAGGAAGGGAGCCAGG - Intronic
920037896 1:203077338-203077360 GAGAGAAGGGGAAGGGATGCTGG - Exonic
920047617 1:203143669-203143691 GAGAATGAGGGACTGGGGGCAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920304036 1:205007483-205007505 GAGAAAAAAGAAAGGGAGGGAGG + Intronic
920329230 1:205193503-205193525 GAGAAAAAGGGGAGGCAGACAGG - Intronic
920850478 1:209624935-209624957 GAAAAAAAGGGAAGGAAGGAAGG + Intronic
920887942 1:209951279-209951301 GAGAAGAAGGGAATGGAGAGGGG - Intronic
921058623 1:211563850-211563872 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
921213195 1:212916982-212917004 GAGGATAGGGGAGGGGAGGAAGG - Intergenic
921474504 1:215590421-215590443 GAGAAAAGAGGAAGGGAGACAGG - Intronic
921572038 1:216791292-216791314 GAGAAAGAGGGAAGAGAGTCGGG - Intronic
921790514 1:219284813-219284835 GAGAGTTGGGGAATGGAGGCAGG - Intergenic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922233906 1:223708857-223708879 GAGAAAAAGAGAAGGAAGGAAGG + Intronic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922453298 1:225754021-225754043 GAGAAAAAGGGCATGGAGGAGGG - Intergenic
922551362 1:226496961-226496983 GGGAAGAAGGGAGGGCAGGCAGG + Intergenic
922887072 1:229028346-229028368 GAGGAGAATGGAAGGGAGGAAGG + Intergenic
922889362 1:229048290-229048312 TAGCATCAGGGAGGGGAGGCAGG - Intergenic
923332933 1:232942502-232942524 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
923386790 1:233472905-233472927 GAGAGTCAGTGAAGGGAGACAGG + Intergenic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923566508 1:235080410-235080432 AAAGAGAAGGGAAGGGAGGCAGG + Intergenic
923784480 1:237054259-237054281 GAGGAAAAGGGAAGGAAGGGAGG - Intronic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924448548 1:244156962-244156984 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
924544845 1:245016802-245016824 AAGAATAAGGCAAGGTAGGCAGG + Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924585728 1:245359684-245359706 GGGAAGGAGGGAAGGGAGGGAGG - Intronic
924643287 1:245853960-245853982 GAGAAAGAGGCAAGGGAGGTGGG - Intronic
924728721 1:246692759-246692781 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
924743723 1:246813491-246813513 GAGAATCAGCAAAGGGAGACAGG - Intergenic
924949797 1:248872134-248872156 AAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1062813914 10:485319-485341 GAGAATGAGGGAGGGGGCGCAGG + Intronic
1062930493 10:1349303-1349325 GAGAGTCAGCGAAGGGAGGTAGG - Intronic
1062931292 10:1354454-1354476 GAGAATCAGCGAAGGGAGATGGG - Intronic
1063071376 10:2669822-2669844 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
1063576318 10:7265196-7265218 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1063668558 10:8081325-8081347 GAGAAAATGGGCTGGGAGGCTGG + Intergenic
1063876387 10:10483858-10483880 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1063978866 10:11437895-11437917 ATGAAGAAGGGAGGGGAGGCGGG - Intergenic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064341513 10:14489896-14489918 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1064723622 10:18255239-18255261 GAGAATAAAGTAAGAGAGGGAGG - Intronic
1064895356 10:20229183-20229205 ATGAATGAGGGAAGGGAGACAGG + Intronic
1064932494 10:20642824-20642846 GGGAATAAAGGAAGCGGGGCTGG + Intergenic
1065202840 10:23331058-23331080 GAGAAACAGGGAAGGGAGGAGGG + Intronic
1065351559 10:24800132-24800154 CTAAATAAGGGAAGGCAGGCAGG - Intergenic
1065608545 10:27446776-27446798 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1065608552 10:27446858-27446880 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1065689087 10:28315182-28315204 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1065699783 10:28413850-28413872 TAGAATAAAAGAAAGGAGGCCGG + Intergenic
1065745397 10:28836487-28836509 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1065867115 10:29923976-29923998 GATAATTAGGGAAAGGAAGCAGG + Intergenic
1065874338 10:29983877-29983899 GAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1065963638 10:30753838-30753860 GTGAATAAGAAAAGGAAGGCAGG - Intergenic
1066340721 10:34530163-34530185 GAGAAGGTGGAAAGGGAGGCAGG + Intronic
1066375885 10:34857309-34857331 GAGAAAGAAGGAAGGGAGGGAGG - Intergenic
1066523382 10:36247959-36247981 GAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1066641754 10:37560952-37560974 AAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1067167595 10:43878043-43878065 GAGAAGGAGGGAATGGAGGAAGG - Intergenic
1067408389 10:46044127-46044149 GACACAAAGGGAAGGAAGGCTGG - Intronic
1067662571 10:48247422-48247444 GAGAAAATGGGAAGGGAGACAGG + Intronic
1067991526 10:51218866-51218888 GAGAAGAAGGGGAGGAAGGAAGG + Intronic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068302979 10:55169978-55170000 TAGAATAAAGGAAGGAAGGAAGG + Intronic
1068310439 10:55267099-55267121 AAGAATAAAGGAAGGCAGGGAGG + Intronic
1068662488 10:59637069-59637091 AAGAAGAAAGGAAGGCAGGCAGG - Intergenic
1068715583 10:60184211-60184233 GAGAAGAGGGAAAGGTAGGCAGG + Intronic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1069637758 10:69936058-69936080 GGGAGTGAGGGAAGGGAGGGAGG + Intronic
1069637770 10:69936087-69936109 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1070358027 10:75659339-75659361 GAGAGGAAAGGGAGGGAGGCAGG - Intronic
1070469683 10:76766484-76766506 GTGAAGAAAGGAAGGGAGGAAGG + Intergenic
1070490248 10:76969276-76969298 GGGAAGAAGGGAAGGAAGGAAGG + Intronic
1070597908 10:77845602-77845624 GGGAAGAAGGGAAGGAAGGAAGG + Intronic
1070659485 10:78294217-78294239 GAAAAGAAAGGAAGGGAGGGAGG - Intergenic
1070789294 10:79180103-79180125 GAGAACAAGGGAAGAGGGGATGG + Intronic
1070888620 10:79925842-79925864 GAGAAGTCGGGAAGGGAGGAAGG - Intergenic
1071125848 10:82333892-82333914 GAGAAAAAGGGATGGGAGCCGGG + Intronic
1071554881 10:86594287-86594309 GAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1071779122 10:88823266-88823288 AAGAATAAGGTAAGGGAGGGTGG - Exonic
1071919028 10:90328836-90328858 GAGAATAATGGGAGGAAGGTGGG - Intergenic
1072351166 10:94558895-94558917 GAGAGTAAGGGAAAACAGGCTGG - Intronic
1072445712 10:95496997-95497019 GAGAGTAAGGTTAGGGAGTCTGG - Intronic
1072586783 10:96789927-96789949 GAGAAGGAGGGAAGGAAGGAGGG - Intergenic
1072742553 10:97918205-97918227 GGAAATAAGGGAAGGGACGAGGG - Intronic
1072813957 10:98486543-98486565 GTGAGTCAGGGAAAGGAGGCTGG + Intronic
1072916018 10:99537634-99537656 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1072926944 10:99624048-99624070 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1072934571 10:99699884-99699906 AAGAAGGAGGGAAGGGAGGGAGG - Intronic
1073159258 10:101375530-101375552 GAGAATAATGGCAGGGAGTCTGG + Intronic
1073294945 10:102433262-102433284 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1073361440 10:102902537-102902559 GAGAGGAAGGGAGGGGAGGGAGG + Intergenic
1073448535 10:103595559-103595581 GAGAAAAAAGGGAGGGAGGGAGG - Exonic
1073565793 10:104534683-104534705 AAGAGGAAGGGAAGGGAGGAGGG - Intergenic
1073643858 10:105279406-105279428 GAGAGGAAGGGAAGGAAGGAAGG - Intergenic
1074242678 10:111654581-111654603 GGGAAGAAGGGAAGGGAAGGGGG - Intergenic
1074311803 10:112328772-112328794 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1074336466 10:112581266-112581288 TTGAATATGGGAAGGGAGGGAGG - Intronic
1074460863 10:113635797-113635819 GAGCATAAGGGAAGGAGAGCAGG - Intronic
1074533248 10:114311131-114311153 GAGACTCTGGGAAGGGAGGCTGG + Intronic
1074724120 10:116289882-116289904 GAGAGAAAAGGAAGGGAGGGAGG - Intergenic
1074885440 10:117689327-117689349 GGGAAGAAGGGGAGGGAGGTGGG + Intergenic
1075190284 10:120300812-120300834 TAGGAGAGGGGAAGGGAGGCTGG + Intergenic
1075238635 10:120756923-120756945 GAGAATAAGTGTGGGGAAGCTGG - Intergenic
1075442125 10:122488230-122488252 GGGACTCAGGGAAGGGACGCAGG + Intronic
1075667115 10:124239493-124239515 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1076303866 10:129449520-129449542 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1076303879 10:129449556-129449578 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1076530523 10:131141592-131141614 GGGAGCAAGGGAAGGGAGGGAGG - Intronic
1076555279 10:131317521-131317543 GAGAATAGGGGCATGGAGGGTGG - Intergenic
1076762178 10:132611318-132611340 GAGAATGAGGGAGGTGAGGTGGG + Intronic
1076898506 10:133325695-133325717 AAGAGGAAGGGAAGGGTGGCGGG + Intronic
1076973993 11:157418-157440 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
1077272198 11:1686671-1686693 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077272289 11:1686946-1686968 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077761342 11:5102998-5103020 GAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1078227524 11:9405867-9405889 GAGAAGGAGGGAAAGGAGGAAGG - Intronic
1078288063 11:9978166-9978188 GAAATTGGGGGAAGGGAGGCAGG - Intronic
1078472678 11:11604363-11604385 CAGAATCAGTGAAGTGAGGCAGG + Intronic
1078740663 11:14063407-14063429 AAGAAAAAAGGAAGGGAGGAAGG - Intronic
1078850962 11:15163308-15163330 GAGAAGGAAGGCAGGGAGGCAGG - Intronic
1079390475 11:20017952-20017974 GAGAGAAAGGGAAGGGAGGGAGG - Intronic
1079706043 11:23619765-23619787 GAGAGGAAGGGAAGGAAGGAAGG - Intergenic
1080127531 11:28754467-28754489 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1080321386 11:31014231-31014253 GAGAGGAAGGGAGGGGAGGGGGG - Intronic
1080885791 11:36366903-36366925 GAGGAGAAGGGAAGGAAGGGAGG - Intronic
1081067097 11:38557331-38557353 TAGAATACGGGAAGGGAGAACGG + Intergenic
1081132954 11:39402883-39402905 GGGAAGAAAGGAAGGCAGGCAGG - Intergenic
1081328594 11:41776988-41777010 GAGAAAGAGGGAAGGAAGGAAGG - Intergenic
1081401586 11:42649198-42649220 GAAAAGAGGGGGAGGGAGGCTGG - Intergenic
1081503159 11:43687239-43687261 GAGATTAAGGTTAGGGAGGCAGG + Intronic
1081639277 11:44741920-44741942 GAAAAAAAGGGAAGGGAGTGGGG - Intronic
1081718693 11:45270015-45270037 GAAAATAAGGGTAGGGTGGCTGG - Intronic
1081755776 11:45543356-45543378 GCCAAGAAGGGAAGGGAGGCAGG - Intergenic
1082076389 11:47979412-47979434 GAGAAACAGGAATGGGAGGCTGG - Intergenic
1082197161 11:49320679-49320701 GAGAGTCAGTGAAGGGAGACAGG + Intergenic
1082837761 11:57664081-57664103 AAGAAAGAGGGAAGGGAGGGAGG - Intergenic
1082848335 11:57743982-57744004 GAGGCTTAGGGAAGGGAGGAAGG + Exonic
1083156313 11:60825431-60825453 TAGAAGAAGGGAAGGGACACAGG - Intergenic
1083310394 11:61780841-61780863 GAGAGGGAGGGGAGGGAGGCAGG - Intronic
1083331431 11:61900231-61900253 GAGAATGAGGGAAGGGACGGGGG - Intronic
1083559960 11:63665483-63665505 AAGAATAAAGGAAGGGAACCAGG + Intronic
1083630141 11:64091106-64091128 GAGAAGGAGGGAAGAGAGGGTGG + Intronic
1083696197 11:64444398-64444420 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
1083725488 11:64625827-64625849 GAGACTAAGGGAAGTGGGGCAGG - Intronic
1083857722 11:65401356-65401378 GGGAAGCAGGGGAGGGAGGCAGG - Intronic
1084070269 11:66728833-66728855 GAGGAAAGGGGAACGGAGGCTGG - Exonic
1084182314 11:67452956-67452978 GAGAATCAGTGAAGGTAGGAAGG + Intronic
1084393408 11:68892696-68892718 GAGGAGAAGGGGAGCGAGGCTGG + Intronic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1084616155 11:70237295-70237317 GGGAAGAAGGGAAGGCAGGCTGG + Intergenic
1084761141 11:71271925-71271947 GATAATTAGGCAAGGAAGGCTGG + Intergenic
1084870018 11:72092119-72092141 GAGAGTGAGGGTAGGGAGGAAGG - Intronic
1085162329 11:74360271-74360293 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1085294457 11:75423249-75423271 GAGAAGAAGGTAGGGGAGGCAGG + Intronic
1085393054 11:76192360-76192382 GAGAAGGAAGGAAGGGAGGAGGG + Intronic
1085489362 11:76900316-76900338 GAGAAGGTGGAAAGGGAGGCAGG + Intronic
1085559173 11:77454481-77454503 GAGAAGAAGGGAATGGATGCTGG - Intronic
1085597251 11:77821010-77821032 GAAAACAAGGGAAGCGGGGCGGG + Exonic
1085853225 11:80145953-80145975 GGGAAGGAGGGAAGGGAGGAAGG + Intergenic
1085934763 11:81127373-81127395 GAGAGTCAGCGAAGGGAGACAGG - Intergenic
1085992253 11:81863343-81863365 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
1086004760 11:82025741-82025763 GAGAATCAGTGAAGGGAGATGGG - Intergenic
1086034669 11:82402145-82402167 GAGAAAGAGGGAAGGAAGGGAGG + Intergenic
1086174558 11:83874278-83874300 GAGAAGGAAGGAAGGGAGGAAGG + Intronic
1086346935 11:85906361-85906383 GAGATTAAGTGAATTGAGGCTGG - Intronic
1086550806 11:88049516-88049538 GAGAGTCAGCGAAGGGAGACAGG - Intergenic
1086583736 11:88428489-88428511 GGGAATAAGGGTAGGAAGTCAGG + Intergenic
1086658657 11:89387441-89387463 GAGAGTCAGTGAAGGGAGACAGG - Intronic
1086854559 11:91850710-91850732 GAGAAGCAGGGCAGGCAGGCAGG + Intergenic
1086886456 11:92211552-92211574 GAGGATGAGGGGAGAGAGGCTGG + Intergenic
1087093694 11:94300269-94300291 GAGAGGAAAGGAAGGAAGGCAGG + Intergenic
1087175629 11:95092472-95092494 AAGAAGATGGGAAGGGAGGGTGG + Intronic
1087358476 11:97125450-97125472 GAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1087597457 11:100272508-100272530 GAGAATGGAGGAAGGGAGGGAGG + Intronic
1088279826 11:108124571-108124593 TAGAAAAAGGGAAGGGGGCCAGG - Intronic
1088438402 11:109841215-109841237 GAGAAAAAAGGAAGGAAGGAAGG + Intergenic
1088438489 11:109841632-109841654 GAGAACAAGAGAAGGAAGGAAGG + Intergenic
1088533525 11:110836260-110836282 GCCAAGAAGGGAAGGGAGGCAGG - Intergenic
1088537213 11:110874407-110874429 GGGAAGCAGGGTAGGGAGGCAGG - Intergenic
1088555465 11:111055992-111056014 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1088694463 11:112355033-112355055 GAGAGTCAGGGGAGAGAGGCTGG + Intergenic
1089074437 11:115727081-115727103 GAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1089196315 11:116695861-116695883 GAGAAGGAGGGAAGGGAGGAGGG - Intergenic
1089196347 11:116695995-116696017 GAGAAAGAAGGAAGGGAGGAAGG - Intergenic
1089629136 11:119773011-119773033 AAGAACAAGGTCAGGGAGGCTGG - Intergenic
1089691533 11:120189783-120189805 GAGAGAGAGAGAAGGGAGGCAGG + Intergenic
1089876800 11:121730227-121730249 GAGAAGAAGGGACAGGAGGAGGG - Intergenic
1089915976 11:122156753-122156775 AAGAATAAGGAAAGGAAGGAAGG + Intergenic
1089958741 11:122597205-122597227 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1089959243 11:122601016-122601038 GGGAGGAAGGGAAGGCAGGCAGG + Intergenic
1090009921 11:123037089-123037111 GACAATAAGCTAAGTGAGGCCGG + Intergenic
1090350165 11:126102911-126102933 GAGAAGAAAGGAGGTGAGGCTGG + Intergenic
1090444680 11:126753717-126753739 GAGAACTGGGGATGGGAGGCAGG - Intronic
1090560214 11:127924391-127924413 GAGCATTAGGGAAGTGAGGAAGG + Intergenic
1090584398 11:128194707-128194729 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1090626389 11:128612450-128612472 AGGAAGAAGGGAAGGGAGGGGGG - Intergenic
1090668427 11:128930423-128930445 GAGAAGAAGGGATGGGAGCGGGG - Intergenic
1090732198 11:129581578-129581600 GTGAATAAGCGCATGGAGGCAGG + Intergenic
1090854230 11:130598205-130598227 GAGAGTAGGGGAAGGGAGAGTGG + Intergenic
1091142816 11:133250510-133250532 GAGAGGGAGGGAAGGGAGGGAGG + Intronic
1091367225 11:135032462-135032484 AGAAATGAGGGAAGGGAGGCAGG - Intergenic
1091483935 12:865336-865358 GACAAAGAGGGAAGGCAGGCTGG - Intronic
1091618893 12:2070966-2070988 GAGAAGGAAGGAAGGCAGGCAGG - Intronic
1091665515 12:2415898-2415920 GCGCATAAGAGAAGGGTGGCCGG - Intronic
1091799195 12:3314062-3314084 GAGAGCAAAGGCAGGGAGGCTGG - Intergenic
1092414387 12:8279118-8279140 GAGAATCAGCGAAGGGAGATAGG + Intergenic
1092619464 12:10248573-10248595 GAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1093206659 12:16259424-16259446 GGAAATAAGGGAAGGAAGGAGGG - Intronic
1093262025 12:16950421-16950443 GAGGAGGAGGGAAGGAAGGCTGG - Intergenic
1093475312 12:19548314-19548336 GAGAGAAAGGGAAGGAAGGAAGG - Intronic
1093542910 12:20308987-20309009 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1093545315 12:20338395-20338417 GCGGAAAAGTGAAGGGAGGCAGG - Intergenic
1093950925 12:25164411-25164433 GAGAAGAAGGGAATGGAGGGCGG - Intronic
1094146151 12:27230525-27230547 GAGAAAGAAGGAAGGGAGGGAGG - Intergenic
1094329444 12:29275160-29275182 GAGAGTCAGCGAAGGGAGACAGG + Intronic
1094401270 12:30062400-30062422 GAGAGTCAGGGAAGGGAGATGGG - Intergenic
1094704808 12:32904293-32904315 GAGAGCGAGGGAAGGGAGGAAGG - Intergenic
1094704821 12:32904370-32904392 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1094738774 12:33264532-33264554 GGGAAGAAGGGAAGGAAGGAGGG - Intergenic
1095085718 12:38056004-38056026 GGGGAAAAGGGAAGGAAGGCGGG - Intergenic
1095169823 12:39020530-39020552 GGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1095306867 12:40649401-40649423 GAGAACAAGGGAAGGAGGGAAGG + Intergenic
1095506505 12:42904625-42904647 AGGCACAAGGGAAGGGAGGCTGG - Intergenic
1095694537 12:45129564-45129586 GGGAAGAAAGGAAGGGAGGGAGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095983883 12:47987187-47987209 GAGAAGAAGGGAGGGGTGTCAGG + Intronic
1095996037 12:48085448-48085470 GAGAATGAGGGAAGGGCTGAGGG - Intronic
1096155479 12:49339272-49339294 GAGGATCAGGCAGGGGAGGCTGG - Intergenic
1096192740 12:49631002-49631024 GAGAGAAAGGGATGGGAGGCAGG + Intronic
1096499751 12:52057501-52057523 GAGGACAAGGGCAGAGAGGCAGG - Exonic
1096530168 12:52237401-52237423 AAGAGTAGGGGAAGGGAGGCAGG + Intronic
1096640122 12:52987714-52987736 GAGAAGAAAGAAAGGGAGGAAGG + Intergenic
1096949176 12:55446833-55446855 GAGAAAAAGAGATGAGAGGCTGG + Intergenic
1096996302 12:55840358-55840380 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1097008804 12:55938110-55938132 AGGAATAAGGGAAAGGAGGATGG - Intronic
1097640228 12:62172238-62172260 GAGGATGAAGGAAGGGAGGAAGG - Intronic
1097680903 12:62647972-62647994 GAAAAAAAGAGAAGGGGGGCGGG + Exonic
1097829127 12:64205604-64205626 GGGAAAAAGGGAAGGAAGGAAGG + Intronic
1098028392 12:66230082-66230104 GAGCATCAGGGCAGGGAGGGAGG + Intronic
1098053850 12:66482700-66482722 GAAAATAAAGGCAGGGAGACAGG + Intronic
1098110574 12:67117731-67117753 GAGAATTAGGGAAGGAAGGAAGG - Intergenic
1098177309 12:67806129-67806151 GGGAAGAAAGGAAGGGAGGAAGG - Intergenic
1098220314 12:68263537-68263559 GCAAAGAAGGGAAGGGAGGGAGG + Intergenic
1098243239 12:68488981-68489003 GAACATAAGGGAATGGGGGCTGG - Intergenic
1098752864 12:74317821-74317843 GGGAAAAAAGGAAGGGAGGGAGG - Intergenic
1098791856 12:74834298-74834320 GAGAACAAAGGAAGGAAGGAAGG - Intergenic
1098826975 12:75308660-75308682 GAAAATAGGGGAAATGAGGCAGG + Intronic
1098918813 12:76284166-76284188 AGGAAGAAGGGAAGGGAGGGAGG + Intergenic
1098920471 12:76297664-76297686 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
1099385295 12:82006222-82006244 GAGAAGAAGGGAAGGAGGGAGGG + Intergenic
1099464827 12:82970814-82970836 GAGAAAAAGGGAAGTGAGCCTGG - Intronic
1099623611 12:85036684-85036706 GACAAGAAGGGAAGGAAGGAAGG - Intronic
1100034447 12:90234335-90234357 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
1100137096 12:91566952-91566974 GGGAAGGAGGGAAGGGAGGTGGG - Intergenic
1100214008 12:92428686-92428708 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1100316776 12:93452055-93452077 GAGAATGAGTGAAGGCAGGAAGG - Intergenic
1100455973 12:94752136-94752158 AAGAAAAAGGAAAGGAAGGCCGG - Intergenic
1100716755 12:97314010-97314032 CACAAAAAGGGAGGGGAGGCTGG + Intergenic
1100787067 12:98089858-98089880 AGGAAGAAGGGAAGGGAGGGAGG + Intergenic
1100877259 12:98975268-98975290 GAGAAAAAAGGAAGGGAGGGAGG - Intronic
1101128731 12:101666470-101666492 GAGAAGAGGAGAAAGGAGGCTGG - Intronic
1101212745 12:102551023-102551045 GAGAAAAAGGGAAGGAAGGAGGG - Intergenic
1101348219 12:103905430-103905452 GAGAAGAAAGGAAGGAAGGAGGG + Intergenic
1101348267 12:103905560-103905582 GAGAAGAAAGGAAGGAAGGAGGG + Intergenic
1101348280 12:103905610-103905632 GAGAAGAAAGGAAGGAAGGAGGG + Intergenic
1101348306 12:103905677-103905699 GAGAAGAAAGGAAGGAAGGAGGG + Intergenic
1101568824 12:105934647-105934669 GAGAAGCAGGCAAGGGAGGGAGG + Intergenic
1101623865 12:106419165-106419187 AAGAATATGGGAATGGAAGCAGG - Intronic
1101688674 12:107052578-107052600 GGGAATAAAGGAATGGAGACTGG + Intronic
1101787740 12:107900461-107900483 GAGGATAAAGGAAGGAAGGAAGG - Intergenic
1101858609 12:108464492-108464514 GAGAAGAAAGGCAGGGAGGATGG + Intergenic
1101872089 12:108574404-108574426 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
1102194729 12:111016928-111016950 GAGAAGAAGAGAAGGGAGGGAGG - Intergenic
1102406380 12:112677473-112677495 GAGAAAGAGGGAAGGAAGGAAGG - Intronic
1102526582 12:113516275-113516297 AAAAATAAAGGAAGGGAGGAAGG - Intergenic
1102556076 12:113727391-113727413 GAGAAGAAAGAAAGGGAGGAAGG - Intergenic
1102624802 12:114226436-114226458 GGGATTTAGGGAAGGGAGACAGG + Intergenic
1102635509 12:114320170-114320192 GAGAATATTGCAAGGGAGGCAGG - Intergenic
1102746268 12:115251569-115251591 GAGAGAAGGGGAAGGGAGGGTGG + Intergenic
1102804010 12:115763313-115763335 GGGAGGAAGGGAAGGGAGGGAGG + Intergenic
1102984047 12:117264538-117264560 AGGAAGAAGGGAAGGGAGGGAGG - Intronic
1103008483 12:117439782-117439804 GAGAGGAAGGGAGGGGTGGCCGG - Intronic
1103030185 12:117606540-117606562 AGGAAGAAAGGAAGGGAGGCAGG - Intronic
1103030226 12:117606683-117606705 AGGAAGAAAGGAAGGGAGGCAGG - Intronic
1103030254 12:117606792-117606814 GAGGAGAAAGGAAGGGAGGGAGG - Intronic
1103220621 12:119241511-119241533 GGGAAAATGGGAAGGGAGCCAGG + Intergenic
1103251842 12:119506627-119506649 GAGAAGAAGGGAAGGGGGAATGG + Intronic
1103495281 12:121357340-121357362 GAGAAGGAGGGAAGGAAGGGAGG + Intronic
1103677236 12:122665510-122665532 GGGAATGAGGGAAGGAAGGAAGG - Intergenic
1104301611 12:127569855-127569877 GAAAATAAAGGAAGGGAGGATGG - Intergenic
1104386280 12:128354319-128354341 GAGAAGAAAGGAAGTGAGGGAGG - Intronic
1104386491 12:128355666-128355688 GGGAATAAGGGAAGAGGGTCAGG - Intronic
1104508276 12:129353114-129353136 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1104619054 12:130296722-130296744 GATAATAAGTGATGGCAGGCAGG + Intergenic
1104668898 12:130667133-130667155 GAGAGGGAGGGAAGGGAGGAAGG + Intronic
1104768539 12:131345965-131345987 GAGAAGAAGGGCAAGGTGGCAGG + Intergenic
1104841003 12:131825655-131825677 GAGAAAGAGGGGAGGGAGGAAGG - Intergenic
1105341424 13:19529617-19529639 GAAAGTAGGGGAAGGGAGTCAGG - Intronic
1106036822 13:26051429-26051451 GGGAATAAAGGAGGGGAGACGGG - Intergenic
1106125026 13:26894226-26894248 AAGAAGAAAGGAAGGGAGGAGGG + Intergenic
1106132771 13:26953250-26953272 AAGGAGAAGGGAAGGGAGGGGGG + Intergenic
1106313864 13:28576959-28576981 GAGGATGAGTGAAGGGGGGCAGG + Intergenic
1106834230 13:33616249-33616271 GGGAAGAAGGGAAGGGGAGCAGG + Intergenic
1106947057 13:34840265-34840287 GAGAAAGAAGGGAGGGAGGCCGG + Intergenic
1107375185 13:39796644-39796666 GAGAGGAAGGGAAGGGAGGAAGG + Intergenic
1107735064 13:43390843-43390865 CCGAAAAAGGGAAGGGAGGCAGG - Intronic
1107768282 13:43761120-43761142 GAGAATGAGGACAGGAAGGCAGG - Intronic
1107785222 13:43948992-43949014 GGGAATAAGGGAGGGTAGGTTGG + Intergenic
1107819613 13:44274357-44274379 GAGAATAGGCATAGGGAGGCAGG - Intergenic
1108046421 13:46388228-46388250 GAGAAGAAGGGAAGGAGGGAGGG + Intronic
1108790273 13:53961529-53961551 GAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1109099416 13:58161448-58161470 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1109108394 13:58284679-58284701 GAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1109945497 13:69426150-69426172 GAGAGTCAGTGAAGGGAGACAGG - Intergenic
1110051400 13:70905124-70905146 GTAGATAAAGGAAGGGAGGCAGG + Intergenic
1110201102 13:72851473-72851495 GACAAGCACGGAAGGGAGGCTGG + Intronic
1110241696 13:73274653-73274675 GAGAGAAAAGGAAGGGAGGAAGG + Intergenic
1110420677 13:75304331-75304353 GAGAATAAAGCAAGGCAGTCAGG + Intronic
1110490332 13:76096051-76096073 AAGAAAAAGGGAAGGGAGGCAGG - Intergenic
1110649993 13:77933316-77933338 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
1110722535 13:78780473-78780495 AAGAAGAAGGGAAGGGAAGTTGG - Intergenic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1110865648 13:80392538-80392560 GAGAGGAAGGGAAGGGAGTGAGG - Intergenic
1111048375 13:82846621-82846643 GAGAGGAAAGGAAGGGAGGGAGG + Intergenic
1111452617 13:88438736-88438758 GAGGAAAAAGGAAGGGAGGGAGG + Intergenic
1111521133 13:89406169-89406191 GAGAGTCAGTGAAGGGAGACAGG + Intergenic
1111634485 13:90886320-90886342 AAGAGTAAGGGAAGGAAGGAAGG + Intergenic
1111893000 13:94106516-94106538 GAGAGTGAGGGAAGTGAGGGAGG + Intronic
1112007920 13:95270058-95270080 GAGGATAAAGGAAGGGAGGGAGG + Intronic
1112172379 13:96987487-96987509 GTGAATCAGGAAGGGGAGGCTGG + Exonic
1112271965 13:97976658-97976680 GAGAAGGAGGGAGGGGAGACAGG - Intronic
1112444374 13:99450845-99450867 GAGAATGAGGGATAGGAGACAGG - Intergenic
1112803937 13:103141353-103141375 GAGAAAAGAGGAAGGAAGGCGGG - Intergenic
1113087241 13:106581177-106581199 GAGAGTGAGGGAACTGAGGCAGG + Intergenic
1113110183 13:106814323-106814345 AGGAAGAAGGGAAGGGAGGAAGG + Intergenic
1113322174 13:109244689-109244711 GAGAGAAAGGGAAGGTTGGCGGG + Intergenic
1113673981 13:112195816-112195838 GGGAAGAAGGGAAGGAAGGAAGG - Intergenic
1113741230 13:112713920-112713942 GGGAAGAATGGAAGGGAGGCTGG - Intronic
1114601070 14:23955766-23955788 GCCAATAAAGGAAGGGAGCCTGG - Intronic
1114602563 14:23968731-23968753 GGGAATAAGGGAAGCAAGGAAGG - Intronic
1114606932 14:24005860-24005882 GGGAATAAGGGAAGCAAGGAAGG - Intronic
1114974120 14:28072969-28072991 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
1115211755 14:30973392-30973414 GAGAAAGAGAGAAGGGAGGGAGG + Intronic
1116124074 14:40758931-40758953 GAGAGTCAGGGAAGGGAGACAGG + Intergenic
1116255000 14:42542218-42542240 GAGAATAATGGATTGAAGGCTGG - Intergenic
1116340764 14:43720955-43720977 GAGAAAAAGAGAAGGAAGGAGGG - Intergenic
1116470719 14:45282543-45282565 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1116475234 14:45331517-45331539 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1116704395 14:48278565-48278587 GAGAGTCAGCGAAGGGAGACGGG + Intergenic
1116788943 14:49318910-49318932 GAGGAGAAGGGAAGGGAGGGAGG + Intergenic
1117178705 14:53170903-53170925 GGGAAGAAGGGATGGGAGGAAGG + Intergenic
1117402770 14:55372610-55372632 GGGAAGAAAGGAAGGGAGGGAGG - Intronic
1117456149 14:55898905-55898927 AAGAGTAAGGGAGGGGAGGGCGG - Intergenic
1117531138 14:56661558-56661580 GGGAAAGAGGGAAGGGAGGAAGG + Intronic
1117698382 14:58389238-58389260 GGGAGGAAGGGAAGGCAGGCAGG + Intergenic
1117701458 14:58417612-58417634 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
1118225023 14:63890560-63890582 GAGAATGAGGGGAGGGAGACAGG + Intronic
1118339485 14:64882168-64882190 GAGAATAAAAGAAGGGAGAAAGG + Intergenic
1118388157 14:65273934-65273956 GAAAATGAGGGAAGGAAGGAAGG + Intergenic
1118657172 14:67965168-67965190 GAGGATATAGGAAGGGAGGGAGG - Intronic
1118663113 14:68037059-68037081 AAGGATAAAGGAAGGGAGGGAGG - Intronic
1119165903 14:72492559-72492581 GAGAAAAAGGGATGGGAGACGGG + Intronic
1119611534 14:76067267-76067289 GAGAAAAATAGAAGAGAGGCCGG + Intronic
1119807569 14:77492156-77492178 TAGAATTAGGCAAGAGAGGCTGG - Intronic
1119864017 14:77957844-77957866 GAGAAGGAAGGAAGGCAGGCAGG - Intergenic
1119996055 14:79254885-79254907 GGGAAGAAAGGAAGGGAGGGAGG - Intronic
1120175704 14:81291096-81291118 GAGAAAAAAGGAAAGGAGACAGG + Intronic
1120250875 14:82060998-82061020 GAGAATCAGCAAAGGGAGACAGG + Intergenic
1120306813 14:82781139-82781161 TAGAATAAGGAAGGAGAGGCCGG - Intergenic
1120598045 14:86465395-86465417 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1120746907 14:88160366-88160388 CAGAAGAAAGGAAGGGAGGATGG - Intergenic
1120928107 14:89818447-89818469 GAGAAGAAGGGAAGGAAGGAGGG + Intronic
1120955499 14:90078607-90078629 GAGAGGGAGGGAAGGCAGGCAGG + Intronic
1121090326 14:91176929-91176951 AAGAAGAAGGGAAGGAAGGAAGG - Intronic
1121399993 14:93667184-93667206 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1121559465 14:94863991-94864013 GAAAATAAAGAAAGGGAGGAAGG - Intergenic
1121578745 14:95010486-95010508 AGGAAGAAGGGAAGGGAGGAAGG + Intergenic
1121856238 14:97272723-97272745 AAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1121935740 14:98017027-98017049 GAGAAGGAAGGAAGGAAGGCGGG + Intergenic
1121992533 14:98573635-98573657 GGGTAGAAGGGAAGGGAGGGTGG + Intergenic
1122133066 14:99617331-99617353 GAGGCTGAGGGAGGGGAGGCGGG + Intergenic
1122216974 14:100211244-100211266 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1122320169 14:100850888-100850910 GGGAAAAAGGGAAGAGAGGAAGG + Intergenic
1122381622 14:101310944-101310966 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
1122392525 14:101399939-101399961 GAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1122435746 14:101695494-101695516 AGGAAAAAGGGGAGGGAGGCTGG + Intergenic
1122473329 14:101987226-101987248 GGGAGTAAGGGAAGAGAAGCTGG + Intronic
1122550619 14:102547228-102547250 GAGAATGAAGGAAGGAAGGAAGG + Intergenic
1123196396 14:106620780-106620802 GACAGTGAGGGAAGGAAGGCTGG + Intergenic
1123213325 14:106782759-106782781 GAGAAAAAAGGAAGGAAGGATGG - Intergenic
1202937492 14_KI270725v1_random:104665-104687 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1123414243 15:20083448-20083470 GCAAACAAGGGAAGGCAGGCAGG + Intergenic
1123523585 15:21090559-21090581 GCAAACAAGGGAAGGCAGGCAGG + Intergenic
1123820981 15:24030460-24030482 GAGAATAGGGGCCTGGAGGCAGG - Intergenic
1124211976 15:27770995-27771017 GAAAAGAAGGGAAGGAAGGAAGG - Intronic
1124347954 15:28934867-28934889 GAGCAGGTGGGAAGGGAGGCAGG + Intronic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1124613152 15:31222967-31222989 GAGGAAGTGGGAAGGGAGGCAGG + Intergenic
1124954523 15:34351406-34351428 GAAAAAAAGGGACGGGAGGAGGG + Intronic
1124957776 15:34370922-34370944 GAGGAGAAGGGAAGTGAGGAAGG - Intergenic
1125157583 15:36606380-36606402 GAGAATAAGGGAATGAAGTTTGG + Intronic
1125206549 15:37160151-37160173 GAAAAGAAAGGAAGGAAGGCAGG - Intergenic
1125215577 15:37269646-37269668 GAGGATCAGGGAAGGGAATCCGG + Intergenic
1125610218 15:40964441-40964463 TAGAATGAGGGAATGGAGGAGGG - Intergenic
1125638037 15:41205717-41205739 GAGAAGGAGGGAAGAGAGGAAGG + Intronic
1126175187 15:45729415-45729437 AAGAGAAAGGGAAGGGAGGGAGG + Intergenic
1126388521 15:48119956-48119978 GAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1126417067 15:48428599-48428621 GAGAGGGAGGGAAGGGAGGAAGG - Intronic
1126494065 15:49271076-49271098 GATAATAATGGATGGGCGGCAGG - Intronic
1126590078 15:50330198-50330220 GAGAAGTAGGGAATGGTGGCTGG - Intronic
1126668551 15:51095204-51095226 GAAGATGAGGGAAGGGGGGCGGG + Intronic
1126668559 15:51095225-51095247 GGGAATAAGGGAAGGGGAGCGGG + Intronic
1126668567 15:51095246-51095268 GGGAATAAGGGAAGGGAGCGGGG + Intronic
1126668576 15:51095266-51095288 GGGAATAAGGGAAGGGGGCGGGG + Intronic
1126753254 15:51898818-51898840 GAGAAGAAGGGAAGGAAGGAGGG - Intronic
1126802620 15:52313423-52313445 GAGAATGATGGAAGGAAGGGAGG - Exonic
1126806064 15:52350557-52350579 GTGCACAAGGGCAGGGAGGCAGG + Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127129180 15:55844190-55844212 GAGAGGAAGGGAAAGAAGGCAGG + Intronic
1127267583 15:57374311-57374333 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1127469187 15:59275420-59275442 GAGAGACAGGGAAGGGAGACAGG - Intronic
1127478840 15:59359622-59359644 AGGAAGAGGGGAAGGGAGGCAGG + Intronic
1127522992 15:59761780-59761802 GAGAAAGAGGGAAGGAAGGAAGG - Intergenic
1127582320 15:60349760-60349782 AAGAAAAAGGGAAGGAAGGAAGG + Intronic
1127660734 15:61098064-61098086 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128134283 15:65251179-65251201 CAAAATAAGAGATGGGAGGCAGG - Intronic
1128370532 15:67036004-67036026 GAGGAGAAGGGAAGTGAGGTGGG - Intergenic
1128610643 15:69070431-69070453 GAGAGAAAGAAAAGGGAGGCAGG + Intergenic
1128637593 15:69313199-69313221 GAGAATAAGGGAACCCAGCCAGG + Intronic
1128715401 15:69904216-69904238 CAGAATTAGGGAAGGGCTGCAGG + Intergenic
1129105611 15:73305341-73305363 GAGACTCAGGGAAGGGTGGCAGG + Intergenic
1129180971 15:73875303-73875325 GGGAAGAAGGGAAGGAAGGAAGG + Intronic
1129272152 15:74424710-74424732 GGGACTCAGGGAAGGAAGGCTGG + Intronic
1129384050 15:75185870-75185892 GGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129698516 15:77754297-77754319 GAGAAGGAAGGAAGGGAGGAAGG + Intronic
1130703010 15:86204518-86204540 GAGAAAAAAGGAAGGAAGGAAGG - Intronic
1130710848 15:86279591-86279613 GAGAATAAGGGAGAGGTGGGAGG - Intronic
1130751714 15:86719598-86719620 GAGGAAAAGGGAAGGGAGGGAGG - Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1130838188 15:87672460-87672482 GAAAGTAAAGGAAGGCAGGCTGG - Intergenic
1131399861 15:92115786-92115808 GAGAACTAGGGAAGAGAGGGAGG - Intronic
1131460007 15:92611177-92611199 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1131793543 15:95990472-95990494 GAGAAAAAGGGAAGGCGAGCAGG + Intergenic
1131810043 15:96163619-96163641 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
1131915697 15:97263532-97263554 GAGAAGAAAGGGAGGGAGGGAGG + Intergenic
1132023496 15:98384886-98384908 GAGAAAGATGGAAGGGAGGAAGG + Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132125277 15:99218268-99218290 GGGAAAAAAGGAAGGGAGGGAGG + Intronic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132299484 15:100767305-100767327 AAGGATGAGGGAAGGGAGGGGGG - Intergenic
1132465333 16:74906-74928 GAGAGTCAGGGAAGGGAGATGGG - Intronic
1132936748 16:2485055-2485077 GAGAGTAGGTGGAGGGAGGCTGG - Intronic
1132989835 16:2786951-2786973 GAGGATAAGGGAGGGGAGTGAGG - Intronic
1133036069 16:3035131-3035153 GAGGACAAGGGAAGGGAGTCAGG - Intronic
1133450376 16:5899053-5899075 TGGAATAAGAGAGGGGAGGCAGG - Intergenic
1133593955 16:7272837-7272859 GGGAAGAAGGGAAGGGAGGGAGG - Intronic
1134122813 16:11596751-11596773 GAGAAGAAGGGAGAGGAGGAGGG + Intronic
1134172270 16:11977549-11977571 GACAAGAAGGGAAGGGCTGCAGG - Intronic
1134318190 16:13139204-13139226 GGGAGTGAGGGAAGGGAGGGAGG - Intronic
1134336076 16:13300826-13300848 GAGAAGAGGGGAGGGGAGGGGGG - Intergenic
1134718988 16:16370687-16370709 GAGGATAAGGGAGGGGAAGGAGG - Intergenic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135106754 16:19656360-19656382 GAGAACATGGGAAGGGAAGAAGG + Intronic
1135130738 16:19851856-19851878 GAGGAAAAGGGGAGGGAAGCAGG - Intronic
1135495756 16:22949725-22949747 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1135779698 16:25289582-25289604 GAAAAGAAAGGAAGGGAGGGAGG - Intergenic
1135913118 16:26579130-26579152 GAGAGGGAGGGAAGGGAGGAAGG - Intergenic
1135952491 16:26928101-26928123 GAGAAAAAAGGAAGGAAGGAAGG + Intergenic
1136021175 16:27441074-27441096 GAGAAAAAAGAAAGGGAGGGAGG + Intronic
1136343369 16:29659761-29659783 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1136622100 16:31436180-31436202 CAGGATAAAGGAAGGGAGGTCGG + Exonic
1136776488 16:32874472-32874494 GAGCACAAGGGAAGGGCGACAGG - Intergenic
1136852188 16:33621057-33621079 GAGGAGAAGGGAAGGGAAGAGGG - Intergenic
1136894127 16:33987040-33987062 GAGCACAAGGGAAGGGCGACAGG + Intergenic
1136901053 16:34038489-34038511 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1137379419 16:47983653-47983675 GTGATTAAGGGAAGGAAGGAAGG - Intergenic
1137408416 16:48207915-48207937 GAGAAAGAAGGAAGGAAGGCTGG - Intronic
1137774043 16:51040976-51040998 GAGAAGAAGGGAAGGAGGGAGGG + Intergenic
1138183917 16:54962242-54962264 GAGAAGAAGGGAAGGAAGGAAGG - Intergenic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1138539098 16:57677710-57677732 GAGAACAAGGGCAGAGAGGGAGG - Intronic
1138562273 16:57808625-57808647 GACAATAAGTGAAGGGTGGTGGG - Intronic
1138835283 16:60427434-60427456 GAAAAGAAGGGAAGGAAGGAGGG - Intergenic
1138861921 16:60768816-60768838 GGGAATAAGGGAAAGAAAGCTGG - Intergenic
1138972047 16:62157284-62157306 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
1139004205 16:62551270-62551292 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1139084633 16:63569726-63569748 GGGAATAAAGAAAAGGAGGCAGG + Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1139746819 16:69081634-69081656 AAAAATAAGGGAACTGAGGCCGG - Intronic
1139869054 16:70089423-70089445 GGGAAGAAGGGAAGGAAGGAAGG - Intergenic
1140197723 16:72869097-72869119 GAGAAGACGGAAAGGAAGGCAGG + Intronic
1140386322 16:74542708-74542730 GGGAAGAAGGGAAGGAAGGAAGG + Intronic
1140486229 16:75295832-75295854 GAGAAAAAGGGAAGACAGGTAGG + Intronic
1140851605 16:78939800-78939822 AAGGATGACGGAAGGGAGGCAGG - Intronic
1141457827 16:84155845-84155867 GTGAAAAAGGGAAGGAAGGCAGG - Intronic
1141472091 16:84245823-84245845 AAGAAGAAGGGCAGAGAGGCAGG + Intergenic
1141600528 16:85123608-85123630 GAAAATAAGGGCTCGGAGGCTGG - Intergenic
1141603398 16:85139498-85139520 GGGACCAAGGGAAGGGGGGCAGG + Intergenic
1141688566 16:85583872-85583894 GGGAGTGAGGGAAAGGAGGCAGG + Intergenic
1141734640 16:85844166-85844188 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1141796425 16:86278416-86278438 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
1141796909 16:86281160-86281182 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
1141812312 16:86383698-86383720 GAGGGAAAGGGAAGGGAGGATGG + Intergenic
1141856233 16:86683144-86683166 GAGAAGAAAGGAAGGAAGGGAGG + Intergenic
1142446270 16:90140267-90140289 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
1203078903 16_KI270728v1_random:1136581-1136603 GAGCACAAGGGAAGGGCGACAGG - Intergenic
1142461235 17:95196-95218 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
1142501407 17:335243-335265 GAGAATAAAGGAAATGATGCAGG + Intronic
1143000190 17:3789465-3789487 GAGAGAGAGGGAAGGGAGGGAGG - Intronic
1143072795 17:4311612-4311634 GACAATGAGGGAAGGGAGAAAGG + Intronic
1143091296 17:4450392-4450414 GAGAAGTAAGGAAGGGAGGGAGG - Intronic
1143279828 17:5745263-5745285 GAGTATAAGAGCAGGGAGCCTGG + Intergenic
1143630017 17:8133653-8133675 CACAATGAGGGAGGGGAGGCTGG - Intergenic
1143643777 17:8216192-8216214 GAGACTAGGGGAAGGGAGAAGGG + Intergenic
1143738977 17:8938534-8938556 GAGGATAAGGGGAGGGAGAATGG - Intronic
1143748005 17:9007657-9007679 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1143805662 17:9424211-9424233 GAGAATAACAGCAGGGTGGCCGG + Intronic
1143965888 17:10756274-10756296 GAGAGGGAGGGAAGGAAGGCAGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144572015 17:16406286-16406308 GAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145278996 17:21454985-21455007 GAGAAGAGGGGAGGGGAGGGAGG - Intergenic
1145407402 17:22616178-22616200 GAGAATCAGCGAAGGGAGATAGG - Intergenic
1145868849 17:28257358-28257380 GGAAAGAAGGGAAGGGAGGAAGG + Intergenic
1146321765 17:31852329-31852351 CAGATTAAGGGAAGGAAGGAGGG + Intronic
1146410674 17:32581490-32581512 AAGGAAAAGGGAAGGGAGGGAGG - Intronic
1146513244 17:33468961-33468983 GTGAATAAGGGAAGGAGGTCAGG + Intronic
1146527855 17:33582040-33582062 GAGAATAAGGGTCTGGAGGCAGG - Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1146910742 17:36646859-36646881 AAGAATAGGAGAAAGGAGGCAGG + Intergenic
1146963084 17:37001379-37001401 GAGAAAAAGGTATGGGAGGAGGG + Intronic
1147058205 17:37850880-37850902 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1147167917 17:38603183-38603205 GAGAGACAGGGAAGGGAGGGGGG + Intronic
1147378465 17:40037206-40037228 GAGAAAGAGGGAAGGAAGGAAGG + Intronic
1147707146 17:42433862-42433884 GATAATGAAGGAAGGAAGGCAGG - Intergenic
1148051766 17:44773099-44773121 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1148346748 17:46908415-46908437 GAAAATAGGGTAAGGGAGGAAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1148723079 17:49768777-49768799 GAGTAAGAGGGAAGGGACGCAGG - Intronic
1148860188 17:50600579-50600601 AGGAATAAAGGAAGAGAGGCAGG + Intronic
1148868969 17:50644332-50644354 AGGAAGAAGGGAAGGCAGGCTGG + Intronic
1149048241 17:52272786-52272808 GAGAAAGAGAGAAGGGAGGAGGG + Intergenic
1149108625 17:52998392-52998414 GAAAATAAGGGAAGGGAACAAGG + Intergenic
1149337824 17:55655346-55655368 AAGAAAAAGGGAAGGAAGGGAGG - Intergenic
1149424931 17:56545928-56545950 GAGAGGAAGGGAAGGGAAGGAGG + Intergenic
1149925382 17:60697217-60697239 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1149997143 17:61411338-61411360 GACAATGAGGGCTGGGAGGCCGG - Intergenic
1150032668 17:61755717-61755739 GAGAAGAAAGGAAGGGAGGAAGG - Intronic
1150137463 17:62703746-62703768 GAGCAGCAGGGAAGGGCGGCAGG + Intronic
1150293231 17:63993441-63993463 GAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1150459524 17:65336908-65336930 GAGAAGAAAGGAAGGAAGGAGGG - Intergenic
1150653819 17:67026870-67026892 GGGAAGAAGGGAAGGGCGGGGGG - Intronic
1151050839 17:70977725-70977747 GGGAATGAGGGAAGGAAGGAAGG + Intergenic
1151050999 17:70978550-70978572 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151051009 17:70978576-70978598 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151232331 17:72693985-72694007 GAGAGTCAGGGCAGGGAGGTGGG - Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151518452 17:74612422-74612444 GGGCATGAGGGCAGGGAGGCAGG + Exonic
1151652969 17:75481399-75481421 GAGATTTAGGGAAGGGAGCTGGG + Intronic
1151792856 17:76320298-76320320 GAAAAGAAAGGAAGGGAGGAAGG + Intronic
1151867808 17:76815967-76815989 GGGAGGAAGGGAAGGGAGGGAGG + Intergenic
1152019478 17:77772915-77772937 GAGGAAAAGGGAAGTGAGGGGGG - Intergenic
1152039230 17:77892346-77892368 GAGAAAAAGGGAAGGGGTGGCGG - Intergenic
1152095380 17:78269102-78269124 GGGAGGACGGGAAGGGAGGCGGG + Intergenic
1152196633 17:78922346-78922368 GGGAATAAGAGAAGGCAGCCTGG + Intronic
1152784236 17:82239773-82239795 GCGAAAAAGGGAAGGCAGGAGGG - Exonic
1152830454 17:82494144-82494166 GAGAGGAAGGGAAGAGAGGATGG + Intergenic
1153318926 18:3752542-3752564 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1153364119 18:4234946-4234968 GAGAACAAGGGAGGGGAGGAAGG - Intronic
1153442952 18:5141137-5141159 GAAAATAGGGGAAGGAAGGAAGG - Intergenic
1154095769 18:11413720-11413742 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1154099486 18:11456878-11456900 GAGATTAAGGGAAGAGACCCTGG - Intergenic
1154365898 18:13708766-13708788 GAAAAGAAGGGAATGGAGGCTGG - Intronic
1155050993 18:22147476-22147498 GAGAGAAAGAGAAGGGAGGGAGG - Intergenic
1155243942 18:23889641-23889663 AAGAGGAAGGGAAGGGAGGAGGG + Intronic
1155555762 18:27017602-27017624 TAGAAGAAGGGTAGGGAGGTAGG + Intronic
1155743885 18:29325462-29325484 GAGAAAATGGGATGGCAGGCTGG + Intergenic
1155910839 18:31502771-31502793 GGGAAGAAAGGAAGGGAGGGAGG + Intronic
1155922124 18:31614108-31614130 GAGAGAAAGGGAAGGAAGGGAGG + Intergenic
1155961494 18:31999304-31999326 GAAAAGAAAGGAAGGGAGGGAGG - Intergenic
1156314684 18:35957579-35957601 AAGAACAAAGGAAGGGAGGGAGG + Intergenic
1156314705 18:35957739-35957761 AAGAACAAAGGAAGGGAGGGAGG + Intergenic
1156489378 18:37487248-37487270 GCCAGAAAGGGAAGGGAGGCAGG - Intronic
1156687550 18:39668400-39668422 GAGAAGAAAGGAAGGAAGGAAGG + Intergenic
1156752450 18:40475425-40475447 GAGAGGGAGGGAGGGGAGGCAGG + Intergenic
1156768551 18:40689647-40689669 GAGAATAATGAAGGGGAGACAGG - Intergenic
1157140529 18:45101510-45101532 GAGATTAAGGTAAATGAGGCTGG - Intergenic
1157157598 18:45282820-45282842 GAAAAGAAAGGAAGGGAGGGAGG - Intronic
1157428088 18:47601356-47601378 AAGAGAAAGGGAAGGGAGGAGGG - Intergenic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157542447 18:48521331-48521353 GAGAATTAGAGAAGGGTGACAGG + Intergenic
1157627186 18:49060664-49060686 GAGGAGAGGGGAAGGGAGGGGGG + Intronic
1157757013 18:50227879-50227901 AAGAGTAAGGGAAGGGATGGAGG - Intronic
1158159154 18:54460612-54460634 GGGAAGGAGGGAAGGAAGGCAGG - Intergenic
1158273111 18:55738049-55738071 GAGGAGAGGGGAAGGGAGGAGGG - Intergenic
1158521268 18:58173200-58173222 GAGAAAAAGGGAGGGGAGTTAGG - Intronic
1158528178 18:58234267-58234289 GAGAAGGGGGGAAGGGAGGGAGG - Intronic
1158713207 18:59855314-59855336 GAGAGAAAGGGAAGGAAGGAAGG - Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1158872771 18:61704650-61704672 GAGAATGAGGGATGAGAGACAGG - Intergenic
1159031795 18:63239221-63239243 GAGTATAAAGAAAGGGAGGCTGG + Intronic
1159576320 18:70182482-70182504 CAGCAAAAGGGAAGGGAGGAAGG + Intronic
1159685197 18:71410305-71410327 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
1159688866 18:71460047-71460069 AAGAATAAAGGAAGGCAGCCAGG - Intergenic
1159850663 18:73523322-73523344 GAGAGGAAGGGAAGGGAGGAAGG + Intergenic
1159874995 18:73800932-73800954 GAGAGAAAGGGAGGGGAGGAGGG - Intergenic
1159884435 18:73890888-73890910 GAGAGAAAGGGCAGGGAGGCAGG + Intergenic
1159915929 18:74187678-74187700 GAGGAGAGAGGAAGGGAGGCCGG - Intergenic
1160064090 18:75558807-75558829 TAAAATAAGGGAAGGAAAGCTGG - Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160153413 18:76412605-76412627 TAGAGGAAGGGAGGGGAGGCCGG + Intronic
1160397997 18:78585934-78585956 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1160615203 18:80121151-80121173 GAAAGGAAGGGAAGGGAGGAAGG - Intronic
1160650936 19:227563-227585 AAGAAAAAAGGAAGGGAGGAGGG + Intergenic
1160918048 19:1507031-1507053 GAGCATCAGAGGAGGGAGGCTGG - Intronic
1161260181 19:3333383-3333405 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1161536171 19:4819990-4820012 CAGAATATGGCAAGGGAGCCAGG + Intronic
1161643815 19:5440375-5440397 GAGAAGGAGGGAAGGAAGGGAGG + Intergenic
1161734117 19:5979913-5979935 GGGAACAAGGGGAGGGAGGGAGG - Intergenic
1161754109 19:6119263-6119285 GAAAGGAAGGGAAGGGAGGAAGG - Intronic
1161765790 19:6207862-6207884 AAGAAAGAGGGAAGGGAGGCAGG + Intergenic
1161910775 19:7192226-7192248 GAGAAAGAAGGAAGGGAGGGAGG + Intronic
1161914686 19:7219593-7219615 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1161927593 19:7312817-7312839 AAGAATTAGGGAAAGAAGGCTGG - Intergenic
1161999803 19:7736666-7736688 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
1162058785 19:8081947-8081969 GAGAAACAAGGAAGGGAGGGAGG - Intronic
1162133554 19:8542154-8542176 CAGAATAGGGGATGGGGGGCGGG + Intronic
1162330626 19:10027089-10027111 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1162342258 19:10098526-10098548 AAGCAAAAGCGAAGGGAGGCTGG + Intronic
1162553773 19:11373871-11373893 GACAATGAAGGAAGGGAGGTGGG - Intergenic
1162877638 19:13632581-13632603 GAGAGAGAGGGAAGGGAGGGAGG - Intergenic
1163040459 19:14598402-14598424 GAGAAGAAAGGAAGGAAGGAAGG - Intronic
1163070067 19:14832386-14832408 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1163117391 19:15196667-15196689 AATAATAATGGTAGGGAGGCAGG - Intronic
1163171172 19:15532259-15532281 AAGAAGAAGAGAAGGGAGGAGGG - Intronic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1164115315 19:22214086-22214108 GTGAATAAGGGAGGGGAAACTGG + Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164643302 19:29841995-29842017 CAGAAAAGGGGAAGGGATGCTGG + Intergenic
1164730938 19:30504205-30504227 AAGAAGAAGGGAAGGAAGGGAGG - Intronic
1164802353 19:31088163-31088185 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1164975608 19:32570883-32570905 GAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1165068956 19:33244349-33244371 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1165402774 19:35612548-35612570 GAGAACGAGGGAAGGCGGGCGGG + Intergenic
1165527959 19:36372062-36372084 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1165670286 19:37672432-37672454 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1165922403 19:39307404-39307426 GTCCATAGGGGAAGGGAGGCCGG + Exonic
1166142719 19:40813580-40813602 AAGAAAAAAGGAAGGGAGGGAGG - Intronic
1166192366 19:41183434-41183456 GATAAATAGGGAAGGGAGGAGGG + Intergenic
1166222764 19:41376462-41376484 GCGCAAAGGGGAAGGGAGGCGGG + Exonic
1166536774 19:43579600-43579622 GAGTAAAATGAAAGGGAGGCCGG + Intronic
1166580670 19:43895826-43895848 GGGAGGAAGGGAAGGGAGGGAGG + Intronic
1166704021 19:44898372-44898394 GTGGAGAAGGGAAGGGAGGTTGG - Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167229121 19:48270671-48270693 GAGAAAAAAGGAAGGAAGGAGGG + Intronic
1167417990 19:49386969-49386991 GAGCAGAAGGGAAGGGAGGCGGG + Intergenic
1167418029 19:49387055-49387077 GAGCAGAGGGGAAGGGAGGGGGG + Intergenic
1167674015 19:50873530-50873552 GGGGATAAAGGAAGGGGGGCGGG + Intronic
1167857656 19:52255834-52255856 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1167935722 19:52905388-52905410 GAGAGTCAGGGAAGGGAGATGGG - Intergenic
1167937855 19:52922427-52922449 GAGAATGAGGGAGAGGAGGAGGG - Intergenic
1168085390 19:54042035-54042057 GAGAAGAAGGGAGAGGAGGAAGG + Intronic
1168143984 19:54408764-54408786 GGGAAGGAAGGAAGGGAGGCGGG + Intergenic
1168156065 19:54473464-54473486 GAGAAAGAGAGAAGAGAGGCAGG + Intergenic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925222159 2:2150843-2150865 GAAAAGAAGGGAAGGGAAGGAGG + Intronic
925561736 2:5203571-5203593 GTGGCTAAAGGAAGGGAGGCTGG - Intergenic
926054543 2:9766764-9766786 GAGGAGATGGGAGGGGAGGCAGG - Intergenic
926370437 2:12173271-12173293 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
926438408 2:12861051-12861073 GACAAAAAAGGAAGGGCGGCTGG + Intergenic
926667863 2:15544388-15544410 GGGAAGCAGGGAAGGGAGGAAGG + Intronic
926770436 2:16368319-16368341 AAGAATAAGTCAAGGGAGGGGGG + Intergenic
927060657 2:19416372-19416394 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
927254687 2:21030019-21030041 CAGAATAAGAGAAGAGAGTCAGG + Intronic
927464296 2:23325454-23325476 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
927464310 2:23325494-23325516 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
927835861 2:26398435-26398457 GGGACTTGGGGAAGGGAGGCAGG - Intergenic
928017684 2:27673467-27673489 GAGAAGGAAGGAAGGGAGGAAGG - Intronic
928097524 2:28413565-28413587 GAGAGGCAGGGGAGGGAGGCGGG + Exonic
928194602 2:29206187-29206209 GAGAAGAAAGGGAGGGAGGGAGG - Intronic
928199761 2:29240086-29240108 GAGGAAAAGGGCAGGGAGGAGGG + Intronic
928247869 2:29646815-29646837 GACAATAAAGCAAGGAAGGCAGG - Intronic
928269315 2:29842071-29842093 GAGAAGGAGGGAAGGAAGGAGGG - Intronic
928278388 2:29922012-29922034 GAGGAGAGGGGAAGGGAGGGGGG + Intergenic
928373670 2:30758799-30758821 GGGAGGAAGGGAAGGGAGGGAGG - Intronic
928857663 2:35818660-35818682 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
928908502 2:36394016-36394038 GAGAATAGTGGCAGGGAGCCAGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929342215 2:40834282-40834304 GGGAAGAAGGGAAGGAAGGGAGG - Intergenic
929776949 2:44935839-44935861 GAGGAGAGGGGAGGGGAGGCGGG - Intergenic
929951509 2:46413453-46413475 GGTAATAAGGAAAAGGAGGCTGG + Intergenic
929972996 2:46599991-46600013 GAGAATGGAGGTAGGGAGGCTGG + Intronic
930403983 2:50930383-50930405 GAGAAAAAGAGAAAGGGGGCAGG + Intronic
930418969 2:51125617-51125639 TAGAATAAGGTAAGGGATACGGG + Intergenic
930487625 2:52027284-52027306 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
930511111 2:52346616-52346638 GAGAAAACGGGGAGGGAGCCAGG - Intergenic
930783409 2:55246650-55246672 GGGAAGAATGGAAGGGAGGGAGG + Intronic
930863886 2:56104229-56104251 GAGAAGAAAGGAAGGAAGGAAGG + Intergenic
931007204 2:57865278-57865300 GAGAAAGAAGGAAAGGAGGCAGG + Intergenic
931042370 2:58314448-58314470 GAGAATCAGCGAAGGGAGATAGG - Intergenic
931115174 2:59158377-59158399 GAGAGAAAGGGAAGGAAGGAAGG + Intergenic
931267096 2:60670301-60670323 GGCAATAAGGGAAGGAAGGGAGG + Intergenic
931421405 2:62131492-62131514 GAAAAGAAAGGAAGGCAGGCAGG - Intronic
931785052 2:65611046-65611068 GAGGCAAAGGGAAGTGAGGCTGG - Intergenic
932320699 2:70820226-70820248 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
932433290 2:71687974-71687996 GAGAATATTTGAAGGGAGGAAGG + Intergenic
932458086 2:71862402-71862424 AAGAAGAAAGGAAGGGAGGGAGG - Intergenic
932755066 2:74402112-74402134 GGGAAAAAGGGAAGGGAGGAAGG + Intergenic
933069301 2:77836936-77836958 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
933069323 2:77837015-77837037 GAGAGGGAGGGAAGGGAGGGAGG + Intergenic
933124986 2:78593402-78593424 GAGAAAAAGAGAAGGAAGGAAGG - Intergenic
933171335 2:79129256-79129278 GAGAATGGGGGAAGGCAGGAGGG - Intergenic
933289894 2:80426424-80426446 GAGGAGAAGGGAAAGCAGGCAGG - Intronic
933431502 2:82185917-82185939 AAGAAAAAAGGAAGGGAGGAAGG + Intergenic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
933555484 2:83825508-83825530 GAGAAGAAAGGAAGGAAGGAAGG + Intergenic
933589910 2:84221034-84221056 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
933737269 2:85505102-85505124 GGCAACAGGGGAAGGGAGGCAGG + Intergenic
934124209 2:88870704-88870726 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934654250 2:96108991-96109013 CAGGATAGGGGAAGGGAGGAAGG + Intergenic
934784664 2:96996255-96996277 GAGGAGAAGGGAAGGGATGGAGG - Intronic
934886657 2:98031148-98031170 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
934945761 2:98540226-98540248 GAAAAGAAGAGAAGGAAGGCCGG - Intronic
935302858 2:101708479-101708501 AGGAATAAGGAAAGTGAGGCAGG + Intronic
935415585 2:102813920-102813942 GAGAATGAAGGAAGGGAGGAAGG - Intronic
935874761 2:107494606-107494628 GAGAAGAGGGAAAGGGAGGAAGG + Intergenic
936040670 2:109146850-109146872 GAGAAGAGGGGAAGAGAGGGAGG - Intronic
936233533 2:110724798-110724820 GAGAAGAAAGGAAGGGAGGGAGG + Intergenic
936255085 2:110904372-110904394 GAGAAGCAGGGAAGGGTGGGTGG + Intronic
936346387 2:111678633-111678655 TAGATTCAGGGAAGGGGGGCGGG - Intergenic
936611758 2:114008537-114008559 CAGAATCAGGGAAGGGAAGAAGG + Intergenic
936794658 2:116190637-116190659 GAGAGTCAGGGAAGGGAGATGGG + Intergenic
936846391 2:116840162-116840184 GAGAAGAAAGGAAGGAAGGAAGG + Intergenic
936926568 2:117742966-117742988 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
936987827 2:118328517-118328539 GGGAATCAAGGAAGGGAAGCAGG - Intergenic
936991291 2:118369458-118369480 GAGAGTAAGTGAAGGGAGATAGG + Intergenic
937030406 2:118734321-118734343 AAGAATAAAGGAAGGAAGGGAGG + Intergenic
937078729 2:119125468-119125490 GCAAAGAAGGAAAGGGAGGCCGG - Intergenic
937261649 2:120590426-120590448 GTGAACAAAGGAAGGGAGGGCGG - Intergenic
937357334 2:121206262-121206284 GAGAAGAAAGGAAGGGAGGGAGG - Intergenic
938143974 2:128819120-128819142 GAAAATAAGGGTAAGAAGGCTGG - Intergenic
938182608 2:129196630-129196652 GAGAATTAGTGTTGGGAGGCTGG + Intergenic
938588127 2:132711815-132711837 GAGAAGGAAGGAAGGGAGGCAGG - Intronic
938662164 2:133498425-133498447 GAGAAAAACGGAAGGAAGGAAGG + Intronic
938779059 2:134568226-134568248 AAGAATAAAGGAAAGAAGGCAGG + Intronic
938877353 2:135546341-135546363 GAGAGGAAGGGAAGGGAAGAGGG - Intronic
939121461 2:138122807-138122829 GACAATATGGGAAGAGAGCCAGG + Intergenic
939434169 2:142152652-142152674 AAGAAGAAGCGAAGGGAGGAAGG - Intergenic
939572276 2:143854659-143854681 GAAAATAAGGGAGAGGGGGCAGG + Intergenic
939644094 2:144675226-144675248 TAGAATAAAGGAAGGAAGGGAGG - Intergenic
939733862 2:145819353-145819375 AGGAAGAAGGGAAGGGAGGGAGG - Intergenic
939733873 2:145819385-145819407 AGGAAGAAGGGAAGGGAGGGAGG - Intergenic
940242555 2:151578697-151578719 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
941201202 2:162513201-162513223 GGGAAGGAGGGAAGGGAGGAAGG - Intronic
941267840 2:163385500-163385522 GAGATGCAGGGAAGGGAGCCTGG + Intergenic
941944991 2:171086327-171086349 TAGAAGAAGGGAACAGAGGCTGG + Intronic
942076409 2:172360498-172360520 GGGGATTAGGGAAGTGAGGCAGG - Intergenic
942161966 2:173198766-173198788 GGGAAGAAGAGAAGCGAGGCTGG - Intronic
942251818 2:174053807-174053829 AAGAAAAGGGGAAGGGAGACAGG + Intergenic
942342290 2:174961132-174961154 GGGAGGAAGGGAAGGGAGGGAGG + Intronic
942498754 2:176566046-176566068 GGCAACAAGGGAAGGGAAGCAGG + Intergenic
942672670 2:178392950-178392972 GTGAATAAGGGAATGGAGAAAGG - Intronic
942774485 2:179564858-179564880 GGGGATAGGGGCAGGGAGGCTGG - Intronic
942866088 2:180676713-180676735 GAGAATAGTTGAAGTGAGGCAGG - Intergenic
943016459 2:182516679-182516701 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
944352200 2:198742165-198742187 GGGAAGAAGGGAAGGAAGGAAGG - Intergenic
944527592 2:200635777-200635799 GAGAGTAAGGGAAATGAGGCAGG + Intronic
944736308 2:202569825-202569847 TAGAAAAAGTGAAGAGAGGCAGG + Intergenic
944775570 2:202960745-202960767 GAGAAGGAGGGAAGGCAGGAAGG - Intronic
944999425 2:205332407-205332429 GAGAAAAAGAGAAGGAAGGAAGG + Intronic
945057494 2:205881277-205881299 GAGAGGGAGGGAAGGGAGGGAGG + Intergenic
945455091 2:210042860-210042882 GAGATTCAGGGCAGGGAGACAGG + Intronic
945693977 2:213079505-213079527 GAGAAGAAAGGAAGGAAGGCAGG + Intronic
945773652 2:214077932-214077954 GAGAGAAAGAGAAGTGAGGCAGG - Intronic
945923794 2:215783015-215783037 GAGCATATGGGAAGGGATCCTGG - Intergenic
946068806 2:217013296-217013318 GAGAGTGAGAGAAGGGAGGCAGG + Intergenic
946124089 2:217544476-217544498 GAGTACAAGGGAAGAGAGGCTGG + Intronic
946371219 2:219282618-219282640 AAGAATAAAGGAAGGAAGGAGGG - Intronic
946770123 2:223080267-223080289 GAGAAGGAAGGAAGGGAGGAAGG - Intronic
946784163 2:223224981-223225003 GGGAAGAAAGGAAGGGAGGGAGG + Intergenic
947148016 2:227086376-227086398 GAAAAGAAGGGAAAGGAGGAAGG - Intronic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947493880 2:230618983-230619005 GAGAGAAAGAGAAGGGAGGGAGG + Intergenic
947671110 2:231936034-231936056 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
948188245 2:236038272-236038294 GAGAAGGAAGGCAGGGAGGCAGG + Intronic
948329021 2:237150562-237150584 GAGGAGAATGGAAGAGAGGCTGG + Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948582635 2:238998274-238998296 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
948786952 2:240357665-240357687 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1168817030 20:745008-745030 AAGAATAAGGGAAGGTAGGCTGG + Intergenic
1168845036 20:938732-938754 GGGAGTAGGGGAGGGGAGGCTGG - Intergenic
1169009791 20:2241037-2241059 AAGAAAAAAGGAAGGGAGGGAGG - Intergenic
1169224661 20:3848464-3848486 GAGAATCAGGAAGGTGAGGCGGG - Intronic
1169246355 20:4028247-4028269 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1169621248 20:7508853-7508875 GAGACTAAGATAGGGGAGGCAGG + Intergenic
1169807839 20:9577690-9577712 GAGGATAAGAGGTGGGAGGCAGG - Intronic
1170034017 20:11971159-11971181 GAGAAGGAGGGAAGAGAGGAGGG - Intergenic
1170113184 20:12827509-12827531 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1170128061 20:12987851-12987873 GAGTACAAGGGAAGGAAGCCTGG + Intergenic
1170405617 20:16032732-16032754 GAGAAGAAGGGAAGAAAGGGAGG + Intronic
1170501892 20:16982711-16982733 GGGAGTAAGGGAAGGAAGGAGGG - Intergenic
1170569358 20:17624171-17624193 GTGAAGAAGGGAAGGACGGCAGG + Intronic
1170680589 20:18522078-18522100 GAGAAGAAGGGAATGGAGGGCGG + Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170743943 20:19081688-19081710 GAGAACAAGGGTAGGGAGTAAGG - Intergenic
1170973759 20:21141284-21141306 GGAAATGGGGGAAGGGAGGCAGG + Intronic
1171151892 20:22834799-22834821 GAGAAGAAAGGAAGGAAGGGAGG - Intergenic
1171406966 20:24918075-24918097 GAGAATGATGGAAGGGATGGTGG + Intergenic
1171463368 20:25311289-25311311 GAGAAAAAGGGAGAGGAGTCAGG + Intronic
1171774572 20:29353212-29353234 GAGAAGAAAGGAAGGCAGGAAGG - Intergenic
1171816590 20:29790838-29790860 GAGAAGAAAGGAAGGCAGGAAGG - Intergenic
1171901765 20:30865145-30865167 GAGAAGAAAGGAAGGCAGGAAGG + Intergenic
1171975997 20:31595144-31595166 CAGAACAATGGACGGGAGGCTGG - Intergenic
1172249041 20:33465930-33465952 CAGAACAAGGGAGGGCAGGCGGG + Intergenic
1172293550 20:33792391-33792413 GATGATAAGGGAAGCAAGGCTGG + Intergenic
1172643375 20:36455189-36455211 GAGAGGAAGGGAGGGGAAGCTGG - Intronic
1172740648 20:37163966-37163988 GAAGGAAAGGGAAGGGAGGCAGG - Intronic
1172910614 20:38406770-38406792 GAGAATGGGGGAAGGGAGTTGGG + Intergenic
1172937394 20:38630028-38630050 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1172974529 20:38896050-38896072 GGGAAGAAAGGAAGGGAGGAAGG - Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173080003 20:39856951-39856973 GAAAGAAAGGGAAGGGAGGGAGG - Intergenic
1173155279 20:40603248-40603270 GGGAATGAGGGAAGGGAGGGAGG + Intergenic
1173162851 20:40664933-40664955 CAGAGTCTGGGAAGGGAGGCTGG + Intergenic
1173201661 20:40959498-40959520 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1173443132 20:43095648-43095670 GAGAGAAAGGGAAGAGAGGTGGG - Intronic
1173855026 20:46244718-46244740 GAGAAAAGGGGAAGGGGGGAAGG + Intronic
1173918718 20:46728077-46728099 GAGAAACAAGGAAGGGAGGAAGG + Intronic
1174585538 20:51605246-51605268 GAGAAAAAAGGAAGTAAGGCAGG + Intronic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175154294 20:56959127-56959149 GAGAAAAAGGGAGGGAAGGAAGG - Intergenic
1175175085 20:57106667-57106689 CAGAATAAGGGAATAGATGCTGG + Intergenic
1175287703 20:57848753-57848775 AAGAAGAAAGGAAGGGAGGGAGG - Intergenic
1175291582 20:57879473-57879495 GAGAACAAGTGAAGCAAGGCAGG - Intergenic
1175330101 20:58157846-58157868 GAGAATAGAGGAAGAGAGACTGG + Intronic
1175455071 20:59106382-59106404 CAGAATAAGGGATGGGTGGGGGG - Intergenic
1175474961 20:59265619-59265641 AAGAAGGAGGGAAGGGAGGGAGG - Intergenic
1175870182 20:62205671-62205693 CACAAGATGGGAAGGGAGGCTGG - Intergenic
1175964034 20:62651353-62651375 GAGATTCAGATAAGGGAGGCTGG + Intronic
1176513709 21:7767469-7767491 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1176695557 21:9972822-9972844 GAGTGATAGGGAAGGGAGGCAGG - Intergenic
1176932134 21:14826422-14826444 GGAAATGAGGGAAGGGAGGGTGG - Intergenic
1177120133 21:17127683-17127705 GAGAGTTAGCGAAGGGAGACAGG - Intergenic
1177429552 21:20974137-20974159 AAGCAGAAGGGAAGGGAAGCAGG + Intergenic
1177565183 21:22811000-22811022 GAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178002127 21:28174284-28174306 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1178356424 21:31913482-31913504 GGGAATAGGGGCAGGGTGGCTGG + Intronic
1178481113 21:32979730-32979752 GAGAGAAAGGGAAGGAAGGAAGG + Intergenic
1178647822 21:34397993-34398015 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1178921900 21:36744337-36744359 GAAAAGAAAGGAAGGGAGGGAGG + Intronic
1178980079 21:37256332-37256354 AAGAGTCAGGGAAGGGAGGGAGG + Intronic
1179100491 21:38351725-38351747 GAGAGAAAGGGAAGGAAGGAAGG + Intergenic
1179255905 21:39715014-39715036 GAGAAAAAAGGAAGGAAGGAAGG - Intergenic
1179422050 21:41244360-41244382 GAGAGTCAGTGAAGGGAGACAGG + Intronic
1179790497 21:43753507-43753529 GAGGATCAGGGATGGGAGGCTGG + Intronic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1179983458 21:44908246-44908268 GAGAAGAAGGGGAGGGCAGCAGG - Intronic
1180134008 21:45849156-45849178 GAGAAAAAGGGAAGGAAGGATGG - Intronic
1180156072 21:45977883-45977905 GAGAATAGGGGATGGGAGAGAGG + Intergenic
1180335139 22:11571093-11571115 GAGAAGAAAGGAAGGCAGGAAGG + Intergenic
1180525423 22:16254653-16254675 GAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1180647017 22:17347771-17347793 GAGGACATGGGAAGGGAGGGGGG - Intergenic
1181458166 22:23070977-23070999 GAGGATCAGGGAGGGGCGGCCGG + Intronic
1181628387 22:24136660-24136682 ATCAATAAGGGATGGGAGGCCGG - Intronic
1181683770 22:24514601-24514623 GAGAAGCAGGGATGGGAGGATGG + Intronic
1181779702 22:25183848-25183870 GAAAATGAGGGAAGGAAGGAAGG - Intronic
1181789213 22:25250488-25250510 AAGGAGAAGGGAAGGGAGGGAGG - Intergenic
1181817287 22:25448110-25448132 GAGAAGAAGGAAAGCGGGGCCGG + Intergenic
1181876827 22:25946069-25946091 GGGAAGAGGGGAAGGGAGGTGGG - Intronic
1181920641 22:26317804-26317826 GAGTATCAGGGCAGGGAGGAAGG - Intronic
1181950607 22:26550944-26550966 GGGAAAAAGGGCAGGGAGGCTGG + Intronic
1182103293 22:27672086-27672108 GAGAAAGAGGGAAGGAAGGGAGG + Intergenic
1182403019 22:30097630-30097652 GAGAATAAGGGAGTGTGGGCAGG + Intronic
1182410437 22:30180851-30180873 GGGAAGAAGGGAAGGGAAGAAGG - Intergenic
1182454182 22:30439316-30439338 TAGTTTAAGGGAAGGGTGGCGGG + Intergenic
1182916429 22:34037003-34037025 GAGAAGAAGTGAATGGAGGGTGG - Intergenic
1183058953 22:35323651-35323673 GGAACCAAGGGAAGGGAGGCAGG + Intronic
1183082046 22:35462983-35463005 GAGGAGAAGGGAAGGAGGGCAGG - Intergenic
1183153085 22:36053511-36053533 GAGAAGCAGGGAAGGGAAGGGGG - Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183404708 22:37624772-37624794 GTGAATGAGGGAAGGGTGGGAGG + Intronic
1183506525 22:38212295-38212317 GAAAATAAAGGAAGATAGGCTGG - Intronic
1183710545 22:39501033-39501055 GAGAATAACGGAATGGAACCAGG - Intronic
1183764831 22:39863205-39863227 AAGAATATAGGAAGGCAGGCAGG + Intronic
1183979231 22:41530050-41530072 GAGATTAAGGGTAGGGCTGCTGG - Intronic
1184219751 22:43092094-43092116 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1184624432 22:45712600-45712622 GACATTAAAGGAAGGGTGGCTGG + Intronic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1203237723 22_KI270732v1_random:21974-21996 GAGAAGGAGGGAAGGAAGGATGG + Intergenic
1203290094 22_KI270735v1_random:28269-28291 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1203301297 22_KI270736v1_random:78946-78968 GAGTCTAATGGAAGGGAGGGGGG + Intergenic
1203322949 22_KI270737v1_random:86271-86293 GGAAATGAGGGAAGGGAGGGAGG - Intergenic
949124764 3:433900-433922 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950046405 3:9951067-9951089 GAAGATGAGGGAAGGAAGGCGGG - Intronic
950254888 3:11496406-11496428 GAGTAGAAAGGAAGGGAGGGAGG - Intronic
950352755 3:12373277-12373299 GAGTAAAAGGGAAGGGAGAAGGG + Intronic
950360816 3:12448327-12448349 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360822 3:12448349-12448371 GAGAAGAAGGGAAGGAAGGAGGG + Intergenic
950360832 3:12448389-12448411 GAGAAGAAGGGAAGGAAGGAGGG + Intergenic
950360837 3:12448411-12448433 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360842 3:12448433-12448455 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360847 3:12448455-12448477 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360852 3:12448477-12448499 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360857 3:12448499-12448521 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360861 3:12448521-12448543 GAGAAGAAGAGAAGGAAGGAGGG + Intergenic
950360866 3:12448543-12448565 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360876 3:12448581-12448603 AAGAAGAAGGGAAGGAAGGAGGG + Intergenic
950360881 3:12448603-12448625 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360886 3:12448625-12448647 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360891 3:12448647-12448669 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360896 3:12448669-12448691 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360901 3:12448691-12448713 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360905 3:12448713-12448735 GAGAAGAAGAGAAGGAAGGAGGG + Intergenic
950360910 3:12448735-12448757 GAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360919 3:12448773-12448795 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
950360924 3:12448795-12448817 GAGAAGATGGGAAGGAAGGAAGG + Intergenic
950405811 3:12803843-12803865 GAGGAGTAGGGAAGTGAGGCAGG + Intronic
950448667 3:13053529-13053551 GAGGAAAAGGGAAGGAATGCAGG + Intronic
950635539 3:14311762-14311784 AAGAATGAAGGAAGGGAGGGAGG - Intergenic
950797952 3:15525808-15525830 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
950886081 3:16364081-16364103 GAGAATGTAGGAAGGCAGGCCGG - Intronic
951158837 3:19390380-19390402 AAGAAGAAAGGAAGGGAGACAGG - Intronic
951273770 3:20659814-20659836 GAGAAAGAGGGAAGGAAGGAAGG - Intergenic
951282576 3:20770932-20770954 AAGAATAAAGGAAGGAAGGAAGG + Intergenic
951315550 3:21185799-21185821 GAGAATCAGTGAAGAGAGACAGG + Intergenic
951353420 3:21634298-21634320 GAGAGGAAGGGAAGGGAGAAAGG + Intronic
951505564 3:23441222-23441244 AAGAATTGGGGAAGGAAGGCCGG + Intronic
951523413 3:23630481-23630503 GGGAGGAAGGGAAGGGAGGGAGG + Intergenic
951761757 3:26155544-26155566 GAAAGTAAGGGAAGCGAGGAGGG - Intergenic
952274595 3:31865065-31865087 GAGAAGAAAAGAAGGGAGGGAGG + Intronic
952370790 3:32720922-32720944 GGGAAGAAGGGAAGGAAGGAAGG - Intronic
952635343 3:35522632-35522654 GAGAATGAGGCAGAGGAGGCAGG - Intergenic
952701146 3:36328970-36328992 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
953205340 3:40822777-40822799 GGGAATAAGGGAAGCAGGGCAGG - Intergenic
953449660 3:42995728-42995750 GAGAAGAAGGGGAGGGGAGCAGG - Intronic
953564057 3:44015969-44015991 GGGAGGAAGAGAAGGGAGGCAGG + Intergenic
953802807 3:46040137-46040159 CAAAATAAAGGAAGGGAGACAGG + Intergenic
953879830 3:46685906-46685928 GAGAATTGTGGAAGGGAGGCAGG - Intronic
953973928 3:47368513-47368535 AAGAAAAAAGGAAGGAAGGCAGG - Intergenic
954368307 3:50157394-50157416 GAGAAGGAGGGAAGGAAGGCTGG - Intronic
954630057 3:52043220-52043242 GAGAAAGAGGGAAGGAAGGGAGG + Intergenic
954839019 3:53495048-53495070 GAGAATAAGGGCAGGGACCGCGG + Exonic
954903918 3:54043677-54043699 AAGAAGGAGGGAAGAGAGGCAGG + Intergenic
954992921 3:54856432-54856454 GAGGAAAAAGGAAGGGAGGAAGG - Intronic
955347739 3:58173394-58173416 GAAAAGCAGGGAAGGGAGACTGG + Intergenic
955874545 3:63476073-63476095 AAGAATAGAGGAAGGGAGGGAGG + Intronic
955877346 3:63506130-63506152 GAGGAAAAGGGAAGAGAGGAAGG - Intronic
956094745 3:65704071-65704093 GAGAAGAGGGGAAAGAAGGCAGG + Intronic
956158042 3:66318468-66318490 GAGAGCAAGGAAAGGCAGGCTGG - Intronic
956321952 3:68007609-68007631 GAGAGGAAGGGAGGGGAGGGAGG - Intronic
956732047 3:72205217-72205239 GAGAAAGAGGGAAGGAAGGAGGG + Intergenic
956783709 3:72624816-72624838 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
956898510 3:73688470-73688492 ATGAATGAGGGAAGGAAGGCAGG - Intergenic
957049206 3:75398376-75398398 GAGAGTCAGTGAAGGGAGACAGG - Intergenic
957701325 3:83718008-83718030 GAGAAAAAAGAAAGGGAGGGAGG + Intergenic
957850893 3:85806266-85806288 GAAAAGAATGGAAGGGAGGGAGG + Intronic
958005263 3:87802161-87802183 AAGAAGAAAGGAAGGGAGGGAGG - Intergenic
958144882 3:89612072-89612094 GAGAAAAAGAGAAGGGAGGAAGG - Intergenic
958182431 3:90077164-90077186 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
958253586 3:91298876-91298898 GAGAGGGAGGGAAGGGAGGAGGG - Intergenic
958484534 3:94687187-94687209 AAGAATAAGGCTAGGGAGGGAGG - Intergenic
958819172 3:98952806-98952828 CAGAATAAGGGAAGGGTCACAGG - Intergenic
959368102 3:105488725-105488747 GAGAAGGAGGGAGGGGAGGAAGG + Intronic
959970177 3:112400523-112400545 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
960044102 3:113179645-113179667 GTGAAGAGGGGAAGGGAAGCAGG + Intergenic
960338337 3:116445530-116445552 GAGAAACAGGAAAGGGAGGAGGG - Exonic
960362575 3:116731817-116731839 GAGAAAGAGAGAGGGGAGGCGGG + Intronic
960397235 3:117152438-117152460 CTGAAAAGGGGAAGGGAGGCAGG - Intergenic
960770008 3:121183612-121183634 GAAAAGAAAGGAAGGGAGGGAGG + Intronic
960980062 3:123215551-123215573 GGGAAAGAGGGAAGGGATGCTGG + Intronic
961135019 3:124502263-124502285 GGGAAAGAGGGAAGGGAAGCAGG + Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961340119 3:126212273-126212295 AAGAAGAAAGGAAGGGAGGAAGG + Intergenic
961580973 3:127882035-127882057 GAGCAGCAGGGAAGGGAAGCTGG - Intergenic
961972447 3:130984485-130984507 GAGGATGAGGGAAGTGGGGCTGG - Intronic
962236366 3:133710819-133710841 GAGGAGGAGGGAAGGAAGGCAGG - Intergenic
962351784 3:134661693-134661715 GGGAAAAAGGGAAGGAAGACAGG + Intronic
962487381 3:135857788-135857810 GAAAAAGAGGGAAAGGAGGCAGG - Intergenic
962619940 3:137168061-137168083 GAAAAGAAAGGAAGGGAGGGAGG - Intergenic
962737575 3:138339405-138339427 GAGGAAAAGGGAGGTGAGGCAGG - Intergenic
962754677 3:138458557-138458579 GAGACTCAGGGAAGGGAGAGGGG - Intronic
962859750 3:139389011-139389033 GAGAAGAAGGGTTGGGAGGAAGG - Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963042460 3:141079751-141079773 GAGAATATGATAAGGGAGGGAGG + Intronic
963252740 3:143118114-143118136 GAGAGTAGGCGAAGGGAGGCTGG + Intergenic
963405390 3:144856657-144856679 GGGAAGAAAGGAAGGGAGGAAGG - Intergenic
963526904 3:146426293-146426315 GGGAAGGAGGGAAGGAAGGCAGG - Intronic
963819091 3:149868514-149868536 AGGAAAAAGGGAAGGGAGGGAGG - Intronic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
964494355 3:157272284-157272306 GAGAGGAAGGGAAGGAAGGAAGG - Intronic
964531364 3:157671442-157671464 GAGAAGAAGGGAAGGAGGGAGGG - Intronic
964677843 3:159303522-159303544 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
964746812 3:160020287-160020309 AAGAAGGAGGGAAGGCAGGCAGG + Intronic
964985414 3:162732336-162732358 GAGAGTCAGGGAAGGGTGGTGGG - Intergenic
965054077 3:163692011-163692033 GGGAAGAAAGGAAGGGAGGGAGG - Intergenic
965070882 3:163913871-163913893 GAGAGTCAGCGAAGGGAGGTAGG - Intergenic
965186932 3:165476621-165476643 GAGAGGGAGGGAAGGGAGGAAGG + Intergenic
965211659 3:165797360-165797382 AAGAATAAAGGAAGGAAGGAAGG - Intronic
965262948 3:166506115-166506137 GAGAGTCAGCGAAGGGAGACGGG + Intergenic
965373931 3:167897707-167897729 GAGAGGGAGGGGAGGGAGGCAGG + Intergenic
965397868 3:168182254-168182276 GAAAAGAAGTAAAGGGAGGCAGG - Intergenic
965654101 3:170965395-170965417 GAAGATAGTGGAAGGGAGGCAGG + Intergenic
965709387 3:171541959-171541981 GAGAAAGAGGGAAGGAAGGAAGG - Intergenic
965728783 3:171747448-171747470 GAGAGGAAGAGAAGAGAGGCAGG - Intronic
965770650 3:172178225-172178247 GAGGTTAAGGGAGGAGAGGCAGG + Intronic
965861399 3:173155314-173155336 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
965862268 3:173161222-173161244 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
966066049 3:175823068-175823090 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
966067706 3:175836105-175836127 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
966140486 3:176751654-176751676 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
966146137 3:176814039-176814061 TAGAAGAAGGGAAGGTGGGCTGG - Intergenic
966177334 3:177152585-177152607 AAGAAAAAGGGTAGGGCGGCCGG - Intronic
966398131 3:179522366-179522388 GAGAATCAGCGAAGGGAGATAGG - Intergenic
966558948 3:181297200-181297222 GAAAATGAGGGATGGGAAGCTGG - Intergenic
966936486 3:184712963-184712985 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
967009967 3:185423529-185423551 AAGAACAGGGGAGGGGAGGCTGG + Intronic
967109475 3:186280993-186281015 CAGAATAAGGGAAGGAAGGTGGG - Intronic
967277996 3:187795369-187795391 GAGAAAAAGGGAAGGAAGGAAGG + Intergenic
967543030 3:190691296-190691318 GGGAATAAAGGAAGGAAGGAAGG + Intergenic
967605358 3:191438537-191438559 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
967644232 3:191901781-191901803 GAGAGTGATGGAAGCGAGGCTGG - Intergenic
967726745 3:192869328-192869350 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
967909303 3:194528021-194528043 GAGAGAGAGGGAAGGAAGGCGGG - Intergenic
967964730 3:194951979-194952001 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
968007929 3:195255648-195255670 GAACACAAGGGAAGGCAGGCAGG + Intronic
968366894 3:198192424-198192446 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
968857495 4:3138116-3138138 GGGAAGTAGGGAAGGGAGGGAGG - Intronic
968955262 4:3715819-3715841 GAGGAAAAGGGAGGGGAGTCAGG + Intergenic
969106791 4:4812346-4812368 GAGAAAAAAGGAAGGAAGGGAGG + Intergenic
969207180 4:5655752-5655774 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
969228990 4:5816678-5816700 GGGGAGAAGGGAAGGGAGGGAGG - Intronic
969270326 4:6095182-6095204 AAGAAGAAAGGAAGGGAGGAGGG + Intronic
969329429 4:6464898-6464920 GAGAAGGAAGGAAGGGAGGAAGG + Intronic
969405660 4:6989791-6989813 AAGAAAAAAGGCAGGGAGGCAGG - Intronic
969495296 4:7522970-7522992 GAGAAGAAAGGAAGGAAGGAGGG - Intronic
969586467 4:8097018-8097040 AGGAAGAAGGGAAGGGAGGGAGG + Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969861563 4:10039872-10039894 AAGAAGAAAGGAAGGGAGGAGGG + Intronic
970155976 4:13142236-13142258 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
970166840 4:13247537-13247559 GAGAAAAAGGGAAAGGAGAATGG - Intergenic
970444527 4:16112716-16112738 GGGAAGAAGGGAGGGGAGGGAGG + Intergenic
970444536 4:16112737-16112759 GGGAAGAAGGGAGGGGAGGGAGG + Intergenic
970444545 4:16112758-16112780 GGGAAGAAGGGAGGGGAGGGAGG + Intergenic
970915662 4:21331324-21331346 GAGAACAAGGGAAGAAAGGAAGG - Intronic
971199795 4:24501308-24501330 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
971394371 4:26214915-26214937 GAGAAAAAAGGAAGGAAGGAGGG + Intronic
971553440 4:27981257-27981279 GAGAGTCAGCGAAGGGAGGTAGG - Intergenic
971563082 4:28106207-28106229 GGGAGGAAGGGAAGGGAGGGAGG + Intergenic
971713635 4:30148892-30148914 GAGAGTCAGTGAAGGGAGACAGG + Intergenic
971782666 4:31056572-31056594 GAGAGGAAGGGAAGGGAGGAAGG + Intronic
972017637 4:34266157-34266179 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
972073716 4:35056556-35056578 GACAACAATGGAAGGAAGGCAGG + Intergenic
972181820 4:36475988-36476010 GAGAATAAGCCAATGTAGGCTGG - Intergenic
972353071 4:38255086-38255108 AAGAATAAAGGAAGGGATGGAGG + Intergenic
972378597 4:38497821-38497843 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
972415738 4:38838894-38838916 GAGAAAAAGAGAAGGAAGGAAGG + Intronic
972415742 4:38838902-38838924 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
972419780 4:38876465-38876487 GAGAATAAGCATAGGAAGGCAGG - Intronic
972889746 4:43542335-43542357 GAGAAAGAAGGAAGGGAGGGAGG - Intergenic
972945117 4:44244466-44244488 GAGAATAAAGGATGAAAGGCAGG - Intronic
973124445 4:46566917-46566939 AAGAAGAAGAGAAGGGAGGAAGG + Intergenic
973224587 4:47768204-47768226 GAGAGTTAGCGAAGGGAGACAGG - Intronic
973334546 4:48942822-48942844 GAGAAAAAGAGAAGGAAGGGAGG - Intergenic
973335803 4:48955389-48955411 GAGGAGAAGGGAAGGGAAGGAGG - Intergenic
973612300 4:52647712-52647734 GAGAACTAGGGAAGGGCTGCAGG - Intronic
973779127 4:54271936-54271958 GAGAATGAAGGAAGGAAGGAAGG - Intronic
973781364 4:54290908-54290930 GGGAAAAAGTGAAGAGAGGCGGG + Intronic
973953758 4:56042503-56042525 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
973972436 4:56226795-56226817 AAGAAAGAGGGAAGGAAGGCAGG - Intronic
974156096 4:58074740-58074762 GAGAAGAAGGGAGGGGAGAAAGG + Intergenic
974840106 4:67289467-67289489 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
975139089 4:70902294-70902316 GAGGGGAAGGAAAGGGAGGCGGG - Intergenic
975319162 4:72990476-72990498 AGGCATAAAGGAAGGGAGGCAGG + Intergenic
976165398 4:82249112-82249134 GGGAATATGGGAAGGGAGGCTGG - Intergenic
976271482 4:83234780-83234802 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
976507194 4:85862077-85862099 GAGAATTAGAGAAGGGGGGAAGG - Intronic
976523649 4:86059980-86060002 GGGAATCAGGGCAGAGAGGCAGG - Intronic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976776124 4:88707876-88707898 GAAAATAAGGGAAGGGAGGAAGG - Exonic
977152704 4:93533347-93533369 GAGAAGTAAGGAAGGGAGGGAGG - Intronic
977330547 4:95631993-95632015 GAGATTAAGGGAATGGAGGTGGG - Intergenic
977416884 4:96744222-96744244 GGGAATAAAGGAAGGAAGGAGGG - Intergenic
977684376 4:99831399-99831421 GATAATGAGGGCAGGGAGTCGGG - Intronic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
977728651 4:100325865-100325887 GAGAAAAGGAGAAAGGAGGCAGG + Intergenic
977990973 4:103442288-103442310 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
978203056 4:106045715-106045737 GAGAATGAGGGAAGGAGGGAGGG - Exonic
978278922 4:106985936-106985958 AAGAAGAAAGGAAGGGAGGAAGG + Intronic
978437481 4:108701299-108701321 GAGAAGAAGGGAGAGGAGGTAGG - Intergenic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
979101136 4:116615630-116615652 GAGAAGGAAGGAAGGGAGGGTGG + Intergenic
979258149 4:118625448-118625470 GAGAATTGGGGGAGGGAGCCAGG + Intergenic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
979538454 4:121851425-121851447 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
979545816 4:121938963-121938985 GGGAACAAGGGAAGGAAGGTTGG - Intronic
979698548 4:123640950-123640972 GTGAAGGAGGGAAGGAAGGCAGG + Intergenic
980472669 4:133268601-133268623 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
980575957 4:134683241-134683263 GAGAGTCAGGGAAGGGAGATGGG + Intergenic
981328619 4:143482415-143482437 GAAAAAAAAGGAAGGGAGGAAGG + Intergenic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981557244 4:146008496-146008518 GAAAGGAAGGGAAGGGAGGGAGG - Intergenic
981557258 4:146008546-146008568 GAAAGGAAGGGAAGGGAGGGAGG - Intergenic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
981963686 4:150575071-150575093 GATAATAAGGGAAGATAGGAAGG + Intronic
982007788 4:151079842-151079864 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
982254228 4:153436558-153436580 GAGAAAGAAGGAAGGGAGGGAGG - Intergenic
982343861 4:154334209-154334231 GAGATTGAGGGAAGGGAGAGAGG + Intronic
982665750 4:158260253-158260275 GAGAAGAAGGGAAGGAGGGAAGG - Intergenic
982708604 4:158737305-158737327 GAGAAGGAGGGAAGGAAGGGAGG + Intergenic
983452005 4:167923198-167923220 GAGAGTCAGGGAAGGGAGACAGG - Intergenic
983977259 4:173950559-173950581 AAGAATATGGGAAATGAGGCCGG - Intergenic
984008520 4:174342473-174342495 GAAAAGAAGGGAAGGAAGGAAGG + Intergenic
984634968 4:182101065-182101087 GAAAAGAAAGGAAGGGAGGGAGG + Intergenic
984720826 4:182970971-182970993 GGGAATAAAGGAAGGAAGGAGGG + Intergenic
984720846 4:182971064-182971086 GGGAATAAAGGAAGGAAGGAGGG + Intergenic
985175670 4:187197032-187197054 GAGAAAGAAGGAAGGGAGGGAGG - Intergenic
985211854 4:187604046-187604068 GAGGAGAAGGGAGGGGAGGAAGG - Intergenic
985224789 4:187748232-187748254 GAGAGCAAAGGAGGGGAGGCAGG + Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985387194 4:189460691-189460713 GGGAAGAAGGGAAGGAAGACAGG + Intergenic
985387204 4:189460745-189460767 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387214 4:189460799-189460821 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387224 4:189460853-189460875 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387233 4:189460907-189460929 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387243 4:189460961-189460983 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387252 4:189461015-189461037 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387262 4:189461069-189461091 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387272 4:189461123-189461145 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387282 4:189461177-189461199 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387292 4:189461231-189461253 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387301 4:189461285-189461307 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985817613 5:2138235-2138257 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
985866848 5:2520583-2520605 TAGAATAAGAGAAGGGGGCCAGG - Intergenic
986485060 5:8227748-8227770 GTGCATAAGTGAGGGGAGGCTGG - Intergenic
986530121 5:8727047-8727069 GCGAGGAAGGGAAGGGAGGGAGG + Intergenic
986773801 5:10995972-10995994 GAGAGAAAGGGAAGGGAGGAAGG + Intronic
986927900 5:12781228-12781250 GAAAAAGAGGGAAGGGAGGAAGG - Intergenic
987907338 5:24093593-24093615 GAGAATAAAGGAAGAGACGGGGG - Intronic
987960185 5:24796968-24796990 GAGTATAAAGGAAGGAAGGCAGG - Intergenic
988427787 5:31083699-31083721 GAGAAGAAAGGAAGGCAGACAGG + Intergenic
988602210 5:32650246-32650268 GTGAATAAGGCAAAGTAGGCAGG - Intergenic
988924600 5:35976879-35976901 GAGAGGAAGGGAAGGAAGGAAGG + Intronic
988932443 5:36049617-36049639 GAGAAAAGGGGAAGGGAGAAGGG - Intronic
989110385 5:37901764-37901786 GAGGGCAAGGGAAGGGAGGAAGG + Intergenic
989263184 5:39442244-39442266 GAAAGTACTGGAAGGGAGGCTGG - Intronic
989333504 5:40287744-40287766 GGTGAAAAGGGAAGGGAGGCAGG - Intergenic
989721386 5:44532650-44532672 GAGGAGAAGGGAAGGAAGGGAGG + Intergenic
990329967 5:54715641-54715663 GAGAGGAAGGGAAGGCAAGCTGG + Intergenic
990485609 5:56257072-56257094 AGGAATGAAGGAAGGGAGGCAGG - Intergenic
990499898 5:56385711-56385733 GAGAAAGAGGAAAGGGAAGCAGG - Intergenic
990597896 5:57329620-57329642 GAGAATCAGGGAAGGGAAGAAGG + Intergenic
990931299 5:61095151-61095173 GAGAACATGGGCAGGGTGGCTGG + Intronic
991185506 5:63801763-63801785 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
991272173 5:64796899-64796921 GAGAAGAAAGGAAGGAAGGGAGG - Intronic
991468123 5:66936454-66936476 GAGAGTCAGGGAAGGGAGATAGG + Intronic
991559534 5:67934922-67934944 GGGAACATGGGAAGGGAGCCAGG + Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991900306 5:71454003-71454025 GAAAGTAATGGGAGGGAGGCTGG - Intergenic
991975163 5:72177957-72177979 GAGAAGGAGGGAAGGGAGGAAGG - Intronic
992175258 5:74143636-74143658 GGGGATAAAGGAAGGGAGGGAGG - Intergenic
992441528 5:76801512-76801534 GAGAACTGGGAAAGGGAGGCTGG + Intergenic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
992844344 5:80730353-80730375 GAGAATAAGTGAAGACATGCAGG + Intronic
992873166 5:81026042-81026064 GAGAAGAAGGGAAGGATGGAAGG - Intronic
993012657 5:82501081-82501103 AAGAAAAAGGGAAGGAAGGGAGG - Intergenic
993224477 5:85149741-85149763 GGGAAGAAGGGAATGGAGACTGG - Intergenic
993359861 5:86960884-86960906 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
993439425 5:87937157-87937179 GAGAAAAAAGGAAGGAAGGAAGG - Intergenic
993877982 5:93330266-93330288 GGGAAAAATGGAAGGCAGGCAGG - Intergenic
993963475 5:94331180-94331202 GAGAAGAAAGGAAGGAAGGAAGG + Intronic
994084517 5:95743681-95743703 GAGAAGAAGGGAGGGAAGGAGGG - Intronic
994190749 5:96866971-96866993 GGGAAAAAGGGAAGTGAGGCAGG - Intronic
995007174 5:107213657-107213679 GAGAGGAAGGCAAGGCAGGCAGG + Intergenic
995083369 5:108079972-108079994 AAGAATTAAGGCAGGGAGGCAGG + Intronic
995824922 5:116285371-116285393 GATAAAAAGGAAAGGGTGGCAGG - Intronic
996109946 5:119553714-119553736 GAGAAAAAAGGAAGGAAGGAAGG - Intronic
996371048 5:122752687-122752709 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
996408575 5:123130324-123130346 GAGAAAAAGGGAAGGAGGGAGGG - Intronic
996523264 5:124450607-124450629 GAGAATAAGGGCAGAGGGGGAGG - Intergenic
996721803 5:126637869-126637891 GGGAGGAAGGGAAGGGAGGAAGG + Intergenic
996992463 5:129651450-129651472 GAGAATGATGGAAATGAGGCAGG - Intronic
997232113 5:132252976-132252998 GAGACTAAGGGATGGCCGGCAGG + Intronic
997709372 5:135990866-135990888 GAGGAGAAGAGAAGGGAGACTGG + Intergenic
997884571 5:137618595-137618617 GAGAATAAGGAATGGTCGGCTGG + Exonic
997899860 5:137754441-137754463 GGGATTAAGGGGAGCGAGGCGGG - Intergenic
997909284 5:137853536-137853558 GAGAATGAGGGGTGGGAGGAGGG + Intergenic
998027776 5:138834876-138834898 GAGAGTCAGCGAAGGGTGGCGGG + Intronic
998506938 5:142679646-142679668 GTAAATAAGAGAAGGGAGGCTGG - Intronic
998594591 5:143515612-143515634 GAGAAGAAAGGAAGGAAGGAAGG - Intergenic
998787235 5:145726211-145726233 GAGAAGAAAGGAAGGAAGGAAGG + Intronic
998857572 5:146408322-146408344 GAGAATAAGAGGAGTGGGGCTGG - Intergenic
998899527 5:146838281-146838303 TAGAAGGAAGGAAGGGAGGCCGG + Intronic
998948564 5:147367500-147367522 GAGAATCAGCGAAGGGAGATAGG + Intronic
999030383 5:148284109-148284131 GAGAGGAAGGAAAGGGAGGGAGG - Intronic
999292712 5:150437236-150437258 GGGAGGAAGGGAAGGCAGGCAGG + Intergenic
999386661 5:151158272-151158294 GGGAAGCAGGGAAGGCAGGCAGG + Intergenic
1000096239 5:157973351-157973373 GGGAAGAAGGGAAGGAAGGGAGG - Intergenic
1000138006 5:158371740-158371762 GAGAAAGAGGAATGGGAGGCAGG + Intergenic
1000210287 5:159101445-159101467 GAGAAAATGGGAAGGAAGGAGGG + Intergenic
1000346751 5:160320935-160320957 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
1000440620 5:161259020-161259042 GAGAAAAGGGGAAGGGGGACGGG - Intergenic
1000579850 5:163022686-163022708 GGGAAGAAGGGAAGGGAGGGAGG + Intergenic
1000602157 5:163287804-163287826 GGAAAAAAGGGAAGGGAGGAAGG + Intergenic
1000903721 5:166937694-166937716 GAAAAGAAAGGAAGGGAGGGAGG + Intergenic
1000944049 5:167398746-167398768 AGGAATAAGGGAAAGGGGGCTGG - Intronic
1001092395 5:168751042-168751064 GAGGCTAGGGGGAGGGAGGCTGG + Intronic
1001165427 5:169361337-169361359 GAAAAAAAGGGGAGGGGGGCAGG + Intergenic
1001268291 5:170291156-170291178 GAGGACAAGGGAAGGGAGGAAGG + Intronic
1001284562 5:170413086-170413108 GTGAATGAAGGAAGGGAGGAAGG + Intronic
1001400773 5:171445209-171445231 GAGAGGCAAGGAAGGGAGGCAGG + Intronic
1001428867 5:171644203-171644225 GAGAATGTGGGAAGGAAGTCAGG + Intergenic
1001437903 5:171714917-171714939 GAGGAAAAGGGGAGGGATGCTGG - Intergenic
1001514348 5:172345007-172345029 GAGAAGGAGGGAAAGGAGGGAGG + Intronic
1001582677 5:172809599-172809621 AGGTATAAGGGAAGGGATGCGGG - Intergenic
1001752445 5:174141970-174141992 GAGACTGAGGGATGGGAGGGAGG + Intronic
1001831482 5:174793155-174793177 GAGAGTAAGGGAGGAGAAGCAGG + Intergenic
1002048571 5:176556025-176556047 GGGAATCATGGGAGGGAGGCAGG - Intronic
1002155541 5:177275727-177275749 AATAATAAGAAAAGGGAGGCCGG - Intronic
1002726118 5:181297622-181297644 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
1003009814 6:2416180-2416202 GAGAAAAAAGGAAGGAAGGAAGG - Intergenic
1003105611 6:3212912-3212934 GAGAATAGGGGAAGAGCAGCTGG + Intergenic
1003610168 6:7606178-7606200 GAGAAGAAGGAAAGAGAGGTGGG + Exonic
1003618894 6:7680028-7680050 GAGAAAAAGGGAAGGGAAGATGG + Intergenic
1003758991 6:9153488-9153510 CAGAATAAGAGAAGAGAGGAGGG + Intergenic
1003759681 6:9162725-9162747 AAGAAAAAAGGAAGGAAGGCAGG + Intergenic
1003945537 6:11072103-11072125 CAGAGAAAGGGAAGGGAGGTGGG + Intergenic
1004015435 6:11727940-11727962 AAGAAGGAAGGAAGGGAGGCAGG + Intronic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004139271 6:13000599-13000621 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1004769135 6:18762167-18762189 GAGAAGGCAGGAAGGGAGGCAGG - Intergenic
1004889891 6:20090431-20090453 GAGAAAAAATGAAGGGAGGAAGG + Intergenic
1005205091 6:23393725-23393747 GGGAAAGAGGGAAGGGAGGGAGG + Intergenic
1005466131 6:26115996-26116018 GAAAATAAAGGAAGGGAGAATGG + Intronic
1005624499 6:27650689-27650711 GAGCATAAGGGGAGGGAGCTGGG + Intergenic
1005665354 6:28047214-28047236 GTGAATAACTGGAGGGAGGCTGG - Intergenic
1005838014 6:29722682-29722704 GAGAAGAAGAGGAGGGGGGCGGG + Intergenic
1005909093 6:30292483-30292505 GTGAAAAAAGGAAGGGAGGGAGG - Intergenic
1005978847 6:30820534-30820556 GTGAATAAGGGCAAGGAAGCAGG - Intergenic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1006099651 6:31678680-31678702 GAAGAAAAGGGAAGAGAGGCTGG + Intronic
1006297999 6:33178599-33178621 GATAGGTAGGGAAGGGAGGCTGG - Intronic
1006488628 6:34366462-34366484 GAGAGAGAGGGAAGGGAGGGAGG + Intronic
1006751094 6:36377610-36377632 GAGTATAAGGGAGCAGAGGCTGG - Intronic
1006827781 6:36948761-36948783 GAAAGAAAGGGAAGGGAGGGTGG - Intronic
1007115019 6:39337266-39337288 GAGGGGAAGGGAGGGGAGGCTGG - Intronic
1007409626 6:41654177-41654199 GAAAGGAAGGGAAGGGAGGGAGG + Exonic
1007675244 6:43588372-43588394 GAAAAGAAAGGAAGGGAGGAAGG - Intronic
1007747347 6:44051346-44051368 GAGTACAAGGGAGGGGACGCTGG + Intergenic
1007812090 6:44493560-44493582 GAGAAGAAGGGAAGGGTGATAGG - Intergenic
1007814948 6:44515036-44515058 GGGAAGAAGGGAAGGGATGAGGG + Intergenic
1007833260 6:44655004-44655026 GAAAGTAAGGGAAGGAAGGAAGG + Intergenic
1007899814 6:45400181-45400203 GGGAATGAGGGAAGGAAGGAAGG + Intronic
1007899822 6:45400209-45400231 GGGAATGAGGGAAGGAAGGAAGG + Intronic
1008140956 6:47831371-47831393 GAGAAAGAAGGAAGGGAGGAAGG - Intronic
1008288398 6:49682765-49682787 AGGAATGAGGGAAGGGAGGGAGG - Intergenic
1008385099 6:50880295-50880317 GAGAAGAAAGGAAGGGAGGAAGG - Intergenic
1008402432 6:51079226-51079248 GAGGATGAGGGAAGTGAGGCAGG + Intergenic
1008435175 6:51467495-51467517 GAGAAGATGGGAAGGGGGGCAGG - Intergenic
1008720036 6:54337825-54337847 TAGAAGAGGGGAAGAGAGGCAGG + Intronic
1008739268 6:54585492-54585514 GAGAATTGTGGAATGGAGGCTGG - Intergenic
1008806916 6:55440851-55440873 GTAAAGAAGGGAAGGAAGGCAGG - Intronic
1008818759 6:55605301-55605323 GAAAGGAAGGGAAGGGAAGCAGG - Intergenic
1008964309 6:57298884-57298906 GAGAATAGGGTGGGGGAGGCAGG - Intergenic
1008969793 6:57354193-57354215 GAGAAGTAGGGAAGGAAGGAAGG - Intronic
1009033521 6:58089444-58089466 GAGAAAGAGGGAAGGAAGGAGGG + Intergenic
1009158758 6:60256019-60256041 GAGAAGTAGGGAAGGAAGGAAGG - Intergenic
1009190885 6:60628152-60628174 GAGAGGGAGGGAAGGGAGGAGGG + Intergenic
1009209131 6:60841157-60841179 GAGAAAGAGGGAAGGAAGGAGGG + Intergenic
1009530548 6:64808035-64808057 GGGAAGAAGGGAAAGGAGGAAGG - Intronic
1009530560 6:64808079-64808101 GGGAAGAAGGGAAGGGAGGAAGG - Intronic
1009530565 6:64808092-64808114 GGGAAGAAGGGAAGGGAAGAAGG - Intronic
1009880373 6:69559813-69559835 GAGAATGAGGGAAGGAGGGCAGG - Intergenic
1009970241 6:70617561-70617583 GAGAATATGGGGTGGGAGGGGGG + Intergenic
1010379963 6:75212960-75212982 GAAAATTAGAGAAGTGAGGCAGG + Intergenic
1010829947 6:80515488-80515510 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
1011085624 6:83537432-83537454 GAGAAAAAGAAAAGGGAGGGAGG - Intergenic
1011085645 6:83537575-83537597 GAGAGAAAGGGAAGGAAGGAAGG - Intergenic
1011105872 6:83780771-83780793 TAGAATAAGGCAGGAGAGGCTGG - Intergenic
1011114328 6:83874106-83874128 GAGAGGAGGGGAGGGGAGGCAGG - Intronic
1011224311 6:85090160-85090182 GTGAACAAGAGAAGTGAGGCTGG - Intergenic
1011530550 6:88316321-88316343 GTAAATGAGGGAAGGGAGGTGGG - Intergenic
1011829114 6:91349181-91349203 GAGAAAAAGAGAAGGGAGAATGG - Intergenic
1012107462 6:95181917-95181939 GAGAAAAAAGGAAGGAAGGGAGG + Intergenic
1012373671 6:98535671-98535693 GAGAAAAAAGGAAGGAAGGAAGG + Intergenic
1012872777 6:104691946-104691968 GGAAAAAAGGGAAGGGAGGGAGG + Intergenic
1012994724 6:105961724-105961746 GAGAAGAAGGGAGGGAAGGAGGG + Intergenic
1013122663 6:107155029-107155051 GATATTAAGGGATGGGAGTCAGG - Intronic
1013201157 6:107897015-107897037 GAGAAGAAGGGAAGGAGGGAGGG + Intronic
1013207626 6:107958637-107958659 TAGAATAGGGGGTGGGAGGCCGG + Intergenic
1013297439 6:108770540-108770562 GAGAGCAATGGATGGGAGGCTGG + Intergenic
1013658587 6:112271253-112271275 GAGAATAAGGGTAGTGATGAAGG - Intergenic
1013658842 6:112273552-112273574 GGGAAGAAGGGAAGGAAGGAAGG - Intergenic
1013689759 6:112627552-112627574 AAGAATAAAGAATGGGAGGCTGG - Intergenic
1014315256 6:119856556-119856578 AAGAAGAAAGGAAGGGAGGGGGG - Intergenic
1014351575 6:120352802-120352824 AAGAAAAAAGGAAGGGAGGGAGG + Intergenic
1014640140 6:123899375-123899397 GAGAAAGAGAGAAGGGAGACAGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014745065 6:125191207-125191229 GAGAATAAAGAAAGCGTGGCTGG - Intronic
1014884817 6:126767047-126767069 GAGACGAAGGGAAGGGAGGGAGG - Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1015054965 6:128889573-128889595 GAAAATAAAGAAAGGGAGGAAGG - Intronic
1015237603 6:130988790-130988812 AAGAATGAAGGAAAGGAGGCTGG + Intronic
1015283468 6:131458678-131458700 AAGAATAAGGGAAGAGACTCAGG - Intergenic
1015567452 6:134588070-134588092 GAGAGAGAGGGAAGGGAGGGAGG + Intergenic
1016064328 6:139663346-139663368 GAGGAGGTGGGAAGGGAGGCAGG + Intergenic
1016180767 6:141145489-141145511 GAGAAAGTGGAAAGGGAGGCAGG - Intergenic
1016344561 6:143098696-143098718 GAGAATAAGGGAGTAGAAGCAGG - Intronic
1016649820 6:146450566-146450588 GAGAATCAGCGAAGGGAGATAGG + Intergenic
1016869198 6:148799649-148799671 GAGAAAAAGGGAAGGAGGGAGGG - Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017041060 6:150309022-150309044 GAGAAAGAGGGAAGGGAGGCAGG + Intergenic
1017041082 6:150309133-150309155 GAGAAAGAGGGAAGGAAGGCAGG + Intergenic
1017502211 6:155036164-155036186 ATGAATAAAGGAAGGGAGGAGGG + Intronic
1017567101 6:155699294-155699316 GAGAGAAAGGGAAGGAAGGAGGG - Intergenic
1017567113 6:155699331-155699353 AAGAATAAAGGAAGGGTGGGAGG - Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1017738877 6:157387186-157387208 AAGAAGAAGGGAAGGAAGGAGGG - Intronic
1017988849 6:159469063-159469085 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1018285867 6:162236890-162236912 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1018302987 6:162423398-162423420 GAGGAAAAGGGAAGGAAGGAGGG - Intronic
1018897069 6:168027154-168027176 TAGAAAAAGGGAAAGGTGGCCGG + Intronic
1019313449 7:373927-373949 GAGGAGAAGGGAAGGGAAGGAGG + Intergenic
1019531680 7:1506548-1506570 GAGAAGAAGGAAGGGGAGGAGGG - Intergenic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019730642 7:2627589-2627611 GAGAGAAAGGGAGGGAAGGCAGG + Intergenic
1019831582 7:3336104-3336126 GAGGACAGGGGAAGGGAGGGTGG + Intronic
1019903797 7:4045039-4045061 GACACTAAGGGAAGGAAGCCAGG - Intronic
1019989172 7:4680587-4680609 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1019989300 7:4681163-4681185 GAGAGGAAGGGAAGGGAGGGAGG + Intergenic
1019989349 7:4681331-4681353 GAGAGGAAGGGAAGGGAGGGAGG + Intergenic
1020127294 7:5540096-5540118 GAGAAGGAAGGAAGGAAGGCAGG + Intronic
1020240379 7:6389958-6389980 GGGAAGAAAGGAAGGGAGGAAGG - Intronic
1020454606 7:8357501-8357523 GAAAAAAATGGAAGGGAGGGAGG - Intergenic
1020779159 7:12496439-12496461 GAGAAGAAGGGAAAGGAGTTTGG - Intergenic
1020929858 7:14379463-14379485 GAGAATAAGGAAAGAGAGTGGGG + Intronic
1021108138 7:16662768-16662790 GAGAAAAAAGGAAGGAAGGAAGG + Intronic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021393333 7:20121048-20121070 GAGAGTCAGCGAAGGGAGACAGG - Intergenic
1021509302 7:21417891-21417913 GAGAAGAAGGGCTGGGATGCAGG - Intergenic
1021510633 7:21428508-21428530 GAGAAGGAGGGAAGGGAGGAGGG - Intronic
1021646161 7:22791525-22791547 GAGAATAACTGCTGGGAGGCTGG + Intergenic
1021656707 7:22880655-22880677 GAAAAGAAAGGAAGGGAGGAGGG - Intergenic
1021877335 7:25060945-25060967 GAGAAAGAGGGAAGGGAGTCTGG - Intergenic
1021934831 7:25620102-25620124 GAGAGCAAGAGAAGGGAGGGAGG - Intergenic
1022194235 7:28049012-28049034 GAGGGGAAGGGAAGGGAGGGAGG - Intronic
1022216068 7:28262811-28262833 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1022278726 7:28883276-28883298 GAGAAGAAAGAAAGGGAGGGAGG - Intergenic
1022381197 7:29861484-29861506 GAAAACAAAGGAAAGGAGGCAGG - Intronic
1022452594 7:30528846-30528868 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1022644178 7:32215547-32215569 GAGACCAATGGGAGGGAGGCAGG + Intronic
1022855034 7:34305229-34305251 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
1023251937 7:38273539-38273561 GTAAAGAAGGGATGGGAGGCTGG - Intergenic
1023400134 7:39786741-39786763 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1023609461 7:41958568-41958590 GAGGGGAAGGGAAGGGAGGGTGG - Intergenic
1023615168 7:42012378-42012400 GAGAAGAAGAAAAGGGAGGGGGG - Intronic
1023732205 7:43202980-43203002 GAGAATCAGCGAAGGGAGATAGG - Intronic
1023739256 7:43263738-43263760 GAGACAAAAGGAAGGGAGGGAGG + Intronic
1023741946 7:43288893-43288915 AAGAATAAGGCAAGAGAGGTAGG - Intronic
1023917019 7:44597121-44597143 GAGAGTGAGGGAAGGGAGGAGGG + Intergenic
1023951260 7:44847955-44847977 GAGAACATGGTAAGGGCGGCCGG - Exonic
1023958611 7:44908151-44908173 GAGAATAAGAGAAGTCAGACAGG - Intergenic
1024225422 7:47322821-47322843 GGGAATCAGGGAGCGGAGGCAGG - Intronic
1024233098 7:47377758-47377780 GAGAAGGAGGGAGGGGAGGAGGG - Intronic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024326702 7:48114679-48114701 GAGAAGGAGGGCAGGGATGCAGG - Intergenic
1024330445 7:48149356-48149378 AAAAAAAAGGGAAGGGAGGGAGG - Intergenic
1024356186 7:48415933-48415955 GAGAGGTAGGGAAGGAAGGCAGG - Intronic
1024486587 7:49926753-49926775 GAGAAAAAGGGAAGGAAGAGAGG + Intronic
1024515345 7:50248209-50248231 GAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1024525262 7:50343175-50343197 GAGACGAGGGGAAGGGAGGGAGG - Intronic
1024529868 7:50382866-50382888 GAGAATATGGGGAGGGGGGATGG - Intronic
1024650270 7:51397696-51397718 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1025132466 7:56383498-56383520 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1025231684 7:57207025-57207047 GAAGATAAGGGAAGGGAAGGAGG - Intergenic
1025788654 7:64667245-64667267 GTGAATTAGGGAGGGGAAGCTGG - Intronic
1026078927 7:67199922-67199944 GAGAAGAAGAGAAGAGAGGGAGG + Intronic
1026241738 7:68581461-68581483 GAAAGGAAGGGAAGGGAGGGAGG + Intergenic
1026300144 7:69090599-69090621 AAGAAGAAAGGAAGGGAGGGAGG + Intergenic
1026393968 7:69932407-69932429 GAGAAAATGGCAAGGGAGGGTGG + Intronic
1026492146 7:70872192-70872214 GGGAGGAAGGGAAGGGAGGGAGG + Intergenic
1026638788 7:72106626-72106648 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1026642579 7:72140329-72140351 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1026675338 7:72423888-72423910 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1026697893 7:72612017-72612039 GAGAAGAAGAGAAGAGAGGGAGG - Intronic
1026781751 7:73272771-73272793 GAGACTCAGGGGTGGGAGGCAGG - Intergenic
1026859994 7:73779840-73779862 GAGAGAAAGGGAAGGAAGGAAGG - Intergenic
1026871068 7:73852201-73852223 GGGAAGCAGGGAAGGGAGGGAGG - Intergenic
1026876272 7:73880769-73880791 GAGAGGAAGGGAAGGGCTGCCGG + Intergenic
1026927414 7:74204092-74204114 GAGAGGGAGGGAAGGGAGGGAGG + Intronic
1027022600 7:74826205-74826227 GAGACTCAGGGGTGGGAGGCAGG - Intronic
1027065412 7:75119704-75119726 GAGACTCAGGGGTGGGAGGCAGG + Intronic
1027227855 7:76255837-76255859 GAAACAGAGGGAAGGGAGGCAGG - Intronic
1027402362 7:77822200-77822222 GAGCAGAGGGGAAGGGAGGTTGG + Intronic
1027500907 7:78950080-78950102 GAGGAAAAGAGAGGGGAGGCAGG - Intronic
1027604615 7:80285351-80285373 GAGAAAAAGTAAGGGGAGGCAGG - Intergenic
1027624141 7:80527317-80527339 AAGAAGGAGGGAAGGGAGGGAGG + Intronic
1027682795 7:81241325-81241347 GAGAATGAGGGGTGGGAGACAGG - Intergenic
1027909912 7:84237459-84237481 GAGAAGAAGGGAGAGGAGGAAGG + Intronic
1028193260 7:87876288-87876310 GAGAGCAACGGAATGGAGGCGGG + Exonic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1028493486 7:91439963-91439985 AAGAAAAAGGGAAGGAAGGGAGG + Intergenic
1028636778 7:92997973-92997995 GGGAAGGAGGGAAGGGAGGAAGG - Intergenic
1028835515 7:95370279-95370301 CAGAATCAGGGAAGGCATGCTGG + Intronic
1028837794 7:95394268-95394290 GACAATAAGGAAAGGGAGGGAGG + Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1028938626 7:96493743-96493765 GAGAAGAAGGCAAGGAAGACAGG - Intronic
1029412854 7:100426871-100426893 GGGAAGCAGGGAAGGGAGGAGGG - Intronic
1029449411 7:100632525-100632547 GAGAAACAGAGAAGGGAGGGAGG - Intronic
1029462121 7:100701295-100701317 AAGAAAAAGGGAAGGAAGGAAGG - Intergenic
1029497265 7:100902762-100902784 GAGAGGAAGGGTAGGGAGACAGG - Intergenic
1029566374 7:101341035-101341057 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1029628847 7:101737753-101737775 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1029628860 7:101737785-101737807 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1029681577 7:102114928-102114950 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1029791828 7:102851460-102851482 GGGAAGAAAGGAAGGGAGGGAGG - Intronic
1029901981 7:104051258-104051280 GAGAATAAGAAAAGGAAAGCTGG - Intergenic
1029923165 7:104287606-104287628 GAGAAGAAGGGAGGGGAGGAGGG - Intergenic
1029941510 7:104485156-104485178 GAGAATAAGATACGGGAGACAGG - Intronic
1030131311 7:106203765-106203787 GAGAAGGTGGGAGGGGAGGCAGG + Intergenic
1030210787 7:106993713-106993735 AAGAAGAAGGGAAGGAAGGAAGG - Intergenic
1030280538 7:107769980-107770002 GAGAAAAAAGGAAGGAAGGAAGG - Intronic
1030540240 7:110821614-110821636 TAGAAAAAGGAAAGGTAGGCTGG + Intronic
1030799761 7:113835475-113835497 GAGAATATGGGAATGGGGGCTGG + Intergenic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1030952442 7:115808142-115808164 CAGAATATGGGATGGGAGCCAGG - Intergenic
1031005145 7:116461059-116461081 GAGAGTCAGGGAAGGGAGATAGG - Intronic
1031143470 7:117971952-117971974 GAGAAAGAGAGAAGGGAGGGAGG - Intergenic
1031214878 7:118877323-118877345 GAAAGGAAGGGAAGGGAGGAAGG + Intergenic
1031345779 7:120664456-120664478 GAGAAGAAATGAAGGGAGGAAGG + Intronic
1031351642 7:120739221-120739243 GAGAATGAAGGGAGGGAGGGAGG + Intronic
1031448087 7:121879761-121879783 AAGAAAAAAGGAAGGGAGGAAGG - Intronic
1031895193 7:127340194-127340216 AAGAAAAAGGGAAGGAAGGAAGG - Intergenic
1032050449 7:128646186-128646208 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1032062260 7:128734979-128735001 GACCATACTGGAAGGGAGGCTGG + Intergenic
1032226079 7:130032763-130032785 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
1032277516 7:130472297-130472319 AAGAAAAAGGGAAGGAAGGAAGG - Intergenic
1032325565 7:130925310-130925332 GAAGAAAAGGGAAGGGAGGAGGG + Intergenic
1032379298 7:131459453-131459475 GAGAATGAGGGAAGACAGGCAGG + Intronic
1032395647 7:131587959-131587981 GAGAGTCAGCGAAGGGAGACAGG + Intergenic
1032573508 7:133027419-133027441 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1032685634 7:134231419-134231441 AAGAAGAAAGGAAGGGAGGAAGG - Intronic
1032774474 7:135096381-135096403 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1032790996 7:135242213-135242235 GAGCAGAAGGGAGGGGAGGGAGG + Intronic
1032899272 7:136288398-136288420 GAGGAACAGGGATGGGAGGCAGG + Intergenic
1032937301 7:136747750-136747772 GACAGTAAGAAAAGGGAGGCCGG + Intergenic
1033124234 7:138693686-138693708 AAGAAGGAAGGAAGGGAGGCAGG + Intronic
1033310661 7:140259704-140259726 GAGAATCAGGGAAGGCAAGATGG + Intergenic
1033392844 7:140944333-140944355 GAAAAAAAGTGAGGGGAGGCTGG - Intergenic
1033573208 7:142654801-142654823 GAGAAGAAGGGAGGGGACACTGG + Intergenic
1033760223 7:144429382-144429404 CAGAATTATGTAAGGGAGGCAGG - Intergenic
1033830850 7:145250595-145250617 GGGAAGAAGGAAAGGGAAGCAGG - Intergenic
1034334639 7:150313168-150313190 GAGAGTCAGCGAAGGGAGGTAGG - Intronic
1034420643 7:150988940-150988962 GGAAAGGAGGGAAGGGAGGCGGG - Intergenic
1034442687 7:151094825-151094847 GGGAAGGAGGGAAGGGAGGGAGG - Intronic
1034606811 7:152323782-152323804 GAGGGGAAGGGAAGGGAGGCAGG + Intronic
1034672082 7:152866666-152866688 GAGAAAAAGGGAAGGGAGGCCGG - Intergenic
1034910015 7:154988239-154988261 GAGGAAATGGGAAGGGAGGAGGG - Intronic
1035011321 7:155717941-155717963 GGGAGGAAGGGAAGTGAGGCAGG - Intronic
1035029518 7:155848385-155848407 GAGAATAGGAGACAGGAGGCTGG - Intergenic
1035078735 7:156199000-156199022 GAGAAGGAAGGAAGGGAGGAGGG + Intergenic
1035105889 7:156441216-156441238 GAGAATGAGGTAAGTGAGGGGGG - Intergenic
1035198839 7:157246684-157246706 GAGAATGAGGGACGGCAGGAAGG - Intronic
1035444757 7:158932684-158932706 GGGAACAGAGGAAGGGAGGCTGG + Intronic
1035471728 7:159114277-159114299 GAGGAGAAGGGGAGGCAGGCAGG + Intronic
1035942965 8:3925075-3925097 AAGAATAAGAGAAGTGGGGCAGG - Intronic
1036472680 8:9064889-9064911 GAGAGTCAGCGAAGGGAGACAGG + Intronic
1036576564 8:10032963-10032985 GGGAAGAAGGGAAGGAAGGGAGG - Intergenic
1036637244 8:10559770-10559792 GAGGAGAAGGGAGGGGAGGTGGG - Intergenic
1036640009 8:10577212-10577234 GAGAGTCAGCGAAGGGAGGTAGG - Intergenic
1037268400 8:17095761-17095783 GACAAAAAAGGAAGGGAGGAAGG - Intronic
1037480644 8:19302174-19302196 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
1037542461 8:19885586-19885608 GAAAAGAAGGAAAGGGAGGAGGG - Intergenic
1037743898 8:21628411-21628433 GAGAAGAAGAGAAGGAAGGAGGG + Intergenic
1037767558 8:21781452-21781474 GAACATAGGTGAAGGGAGGCAGG - Intronic
1038150428 8:24938526-24938548 GAGAATCAGGGCAGGGGGGACGG - Intergenic
1038194342 8:25352843-25352865 CAGGATAAGGGAAGTGAGGGTGG + Intronic
1038448435 8:27620833-27620855 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1038622152 8:29154395-29154417 GGGAAGAGGGGAGGGGAGGCAGG + Intronic
1038689318 8:29746688-29746710 GACAAGAAAGGAAGGGAGGGAGG + Intergenic
1039188300 8:34942278-34942300 GAGAAGGAAGGAAGGAAGGCAGG + Intergenic
1039352951 8:36782301-36782323 AGGAATGAGGGAAGGGAGGGAGG - Intergenic
1039364504 8:36916092-36916114 GAGAAGAAGGGAAGGAAGGAAGG + Intronic
1039474887 8:37834389-37834411 GAGTAGAAGGGATGGGAGGAAGG + Intronic
1039721933 8:40173819-40173841 GAGAATAAGAGAAATGTGGCCGG + Intergenic
1039723057 8:40185544-40185566 AAAAAGAAGGGAAGGGAAGCAGG + Intergenic
1039727418 8:40233796-40233818 AAGAAGAAGGGAAGGAAGGGAGG + Intergenic
1039730426 8:40269811-40269833 GAGGATAGGGGAATGGATGCTGG + Intergenic
1039762404 8:40591564-40591586 AAGAATAAGGGAGGTGAGGCAGG - Intronic
1039902734 8:41765105-41765127 GAGAAAAAGAGAAGGAAGGAAGG - Intronic
1040051899 8:43023409-43023431 GAAAAGAAGGGAAGGAAGGAAGG - Exonic
1040100761 8:43501261-43501283 GGAAGTAAGGGAGGGGAGGCTGG - Intergenic
1040102681 8:43519403-43519425 TATAATAATGGAAGGGAGGGGGG + Intergenic
1040747269 8:50660441-50660463 GAGAAAAAAGAAAGGGAGGAAGG + Intronic
1040837134 8:51744369-51744391 GAGAAAAAAGAAAGGAAGGCTGG + Intronic
1040898204 8:52390229-52390251 GAGATAACGGGAAGGGAGGAAGG - Intronic
1041150807 8:54931734-54931756 GAGAAAGAAGGAAGGGAGGGAGG - Intergenic
1041494000 8:58465903-58465925 GAGAGTTAGGGAAGGGAGATAGG - Intergenic
1041541847 8:58993691-58993713 GAGATCAAGGGCAGGGAGGGAGG + Intronic
1041674087 8:60520695-60520717 CAGAATGAGGGAAGAGAGGAGGG - Intronic
1041748986 8:61238396-61238418 GAAAAGGAGGGAAGGAAGGCAGG - Intronic
1041790953 8:61695575-61695597 GAGAGTAAGGGAAGTGAGGAAGG - Intronic
1041867578 8:62594792-62594814 GGGAAGAAAGGAAGGGAGGAAGG - Intronic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042096473 8:65221437-65221459 GAGAATGAGGCAAGGAAGGGAGG + Intergenic
1042313518 8:67401381-67401403 GAAAAGCAGGGAAGTGAGGCAGG - Intergenic
1042338781 8:67657019-67657041 GAGATTAAGGGTAGGGAGATGGG - Intronic
1042345195 8:67719828-67719850 GAGAATAAGGAAAGGGGGCAGGG + Intronic
1042905258 8:73766048-73766070 GAGGAAAAGGGGAGGGAGGGAGG + Intronic
1043037667 8:75218738-75218760 GAGAAAGAAGGAAGGGAGGAAGG + Intergenic
1043149632 8:76698545-76698567 GAGAATGAGGGAAATGAGGGTGG + Intronic
1043512164 8:80960209-80960231 GAGAAAAAAGGAAGGAAGGAAGG - Intergenic
1043544490 8:81300230-81300252 TATAATAAGGAAGGGGAGGCTGG + Intergenic
1043908439 8:85833332-85833354 GAAAAGAAGGGAAGGGAAGGGGG - Intergenic
1044068543 8:87726493-87726515 CAGAGTAAGGGAAGTGAGGGTGG + Intergenic
1044091685 8:88010331-88010353 GAGAATAAAAGAAGGAAGGATGG - Intergenic
1044093371 8:88030102-88030124 GAAAAGAAGGGAAGAGAGGGAGG + Intergenic
1044291215 8:90472549-90472571 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1044299997 8:90572788-90572810 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1044357058 8:91234855-91234877 GGGAAGAAGGGAAGGAAGGAAGG - Intronic
1045116493 8:98988579-98988601 GAGAATAAAGGACAGGAGCCTGG - Intergenic
1045254450 8:100508095-100508117 GAAGCTTAGGGAAGGGAGGCTGG - Intergenic
1045662257 8:104450106-104450128 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1045789391 8:105964147-105964169 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1046085376 8:109427654-109427676 GAGAATGGGGGAAAGGAGTCAGG + Intronic
1046126055 8:109910165-109910187 AAGAAGAAGGGAGGGGAGGGAGG - Intergenic
1046381870 8:113461322-113461344 GATAATAAGGCAAGGGTAGCAGG + Intergenic
1046554732 8:115760812-115760834 AAGAAGAAAGGAAGGGAGGGAGG - Intronic
1046555428 8:115768227-115768249 GGGAAGAAGGGAAGGGGGGAAGG - Intronic
1046555459 8:115768322-115768344 GGAAAGAAGGGAAGGGAGGAAGG - Intronic
1046555482 8:115768440-115768462 GGGAAGAAGGGAAGGGAAGAAGG - Intronic
1046555498 8:115768497-115768519 GGGAAGAAGGGAAGGGAAGAAGG - Intronic
1046555513 8:115768549-115768571 GGGAAGAAGTGAAGGGAGGGAGG - Intronic
1046555556 8:115768691-115768713 AAGAAGAAGGGAAGGGAAGAAGG - Intronic
1046555585 8:115768787-115768809 GGGAAGAAGGGAAGGGAGGTAGG - Intronic
1046710208 8:117502915-117502937 GAGAATCAAGGAAGGGAGAATGG + Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1047857724 8:128930558-128930580 AAGAAGAAAAGAAGGGAGGCAGG - Intergenic
1048080548 8:131121897-131121919 GAGATGAAGGGAAGAGAAGCTGG + Intergenic
1048285858 8:133141267-133141289 GAGAAAAAAAGAAGGGAGGAAGG - Intergenic
1048391562 8:133970587-133970609 GAAAATAAAGGAAGGAAGGAAGG + Intergenic
1048572230 8:135665659-135665681 GAGAAGAGGGGAAGGTAGACAGG + Intergenic
1048662344 8:136618944-136618966 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
1048673844 8:136754430-136754452 GAGAAAATGGGAAGGGAGTGAGG - Intergenic
1048728704 8:137413579-137413601 GAGAATCAGCGAAGGGAGATGGG + Intergenic
1048888125 8:138924804-138924826 GAGAATAGGGGCCTGGAGGCAGG + Intergenic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049311803 8:141937443-141937465 GAAAAGAAAGGAAGGGAGGGAGG - Intergenic
1049361146 8:142213066-142213088 GAGAGTGAGGGAGGGGAGACAGG - Intronic
1049455534 8:142684494-142684516 GAGAAGAAGGGCAAGGATGCGGG + Intergenic
1049735423 8:144202488-144202510 GAGAGGAAGGGAAGGGAGAACGG + Intronic
1049856953 8:144868203-144868225 GAGAATAAAGGAACGGAGCTGGG + Intergenic
1050174556 9:2855978-2856000 GAGAAGGAAGGAAGGGAGGCAGG + Intergenic
1050327267 9:4509531-4509553 AAGAACAGGGGAAGGGAGGGCGG + Intronic
1050339648 9:4622981-4623003 AAGAATAAGGGTAGCTAGGCCGG + Intronic
1050507962 9:6366852-6366874 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1050511211 9:6397532-6397554 GGGAAGAAGGGAAGGAAGGGAGG + Intergenic
1050641796 9:7676352-7676374 AGGCATAAGGGAAGGGAGGTAGG - Intergenic
1050707910 9:8424723-8424745 AAGAATGAGTGAAGGGAGGAGGG + Intronic
1051312103 9:15786936-15786958 GAGAATCAGTGAAGGGAGATAGG - Intronic
1051467073 9:17391413-17391435 GAGAAAAAGGGGAGGGTGACAGG + Intronic
1051666866 9:19474067-19474089 GACAGGAAGGGAAGGGAGGAAGG - Intergenic
1052143387 9:25017501-25017523 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1052206320 9:25845357-25845379 GAGAAAAAAGGAAGGGAGGGAGG + Intergenic
1052411816 9:28131034-28131056 GGAGATAAGGGGAGGGAGGCTGG - Intronic
1052459967 9:28750398-28750420 TAGAATAAGGGAAGGAAAGGAGG + Intergenic
1052475915 9:28958730-28958752 GAGAAGAAGGGAAGGGAGGGGGG + Intergenic
1052849546 9:33368574-33368596 GAGAGGAAGGGAAGGCAGGATGG + Intronic
1052885756 9:33646866-33646888 GAGAAAAAGGGAGGGGACACTGG + Intergenic
1053208480 9:36207885-36207907 GAGGAAAAGGCAAGGCAGGCTGG - Intronic
1053450690 9:38191985-38192007 GGGGAGAAGGGAAAGGAGGCTGG - Intergenic
1053632540 9:39958773-39958795 GAGTGAAAGGGAAGGGAGGCAGG - Intergenic
1053710374 9:40801094-40801116 GGGAAAGAGGGAAGGAAGGCTGG - Intergenic
1053773220 9:41504758-41504780 GAGTGATAGGGAAGGGAGGCAGG + Intergenic
1054211348 9:62291924-62291946 GAGTGAAAGGGAAGGGAGGCAGG + Intergenic
1054313635 9:63556928-63556950 GAGTGATAGGGAAGGGAGGCAGG - Intergenic
1054377985 9:64463051-64463073 GACACAAAGGGAAGGGAGGACGG - Intergenic
1055348059 9:75357259-75357281 GAGAATCAGTGAAGGGAGATAGG + Intergenic
1055713091 9:79086889-79086911 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1056191238 9:84186252-84186274 GAGGAGAGGGGAAGGGAGGGAGG + Intergenic
1056614852 9:88155652-88155674 GAGAGAAAGGGAAGGAAGGGAGG - Intergenic
1056835641 9:89953143-89953165 GAGAAAAAGAGAGGGGAGGGAGG - Intergenic
1056849310 9:90068682-90068704 GAGAATAAGGGAAGGTTAGGAGG + Intergenic
1056851365 9:90087228-90087250 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1057668706 9:97068770-97068792 GACAATTAAGGAAGGGATGCTGG - Intergenic
1057829321 9:98394855-98394877 CAGAATGAGGGAAGGGATGGTGG - Intronic
1057936610 9:99244918-99244940 GAGAGAAGGGGAAGGGAGACTGG + Intergenic
1059042381 9:110828504-110828526 AAGAAATGGGGAAGGGAGGCGGG + Intergenic
1059064687 9:111070582-111070604 AAGAAAAAGGGAAGGGAGAAAGG + Intergenic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059126419 9:111690885-111690907 GAGAAAAAGGGGAGGGCGGGGGG - Intronic
1059413481 9:114149010-114149032 AAGAATCAGGGAAGGAAGGAGGG - Intergenic
1059618886 9:115981536-115981558 GAGAAAAATGGAAGGAAGGAAGG - Intergenic
1059643662 9:116242365-116242387 AAGAATAAATGAAGGGAGGAAGG + Intronic
1059648271 9:116288478-116288500 GAGAAGGAAGAAAGGGAGGCAGG - Intronic
1059710172 9:116860587-116860609 AAGAATCATGGAAAGGAGGCTGG - Intronic
1059929856 9:119249932-119249954 GAGAGAAAGGGAAGGAAGGAAGG + Intronic
1060205976 9:121683084-121683106 GGGAAGGAGGGAAGGGTGGCAGG + Intronic
1060216645 9:121742542-121742564 GAGAGGAAGGGAAGAGAGACTGG - Intronic
1060327186 9:122628716-122628738 GAGAGTTCTGGAAGGGAGGCTGG + Exonic
1060830921 9:126715657-126715679 GAAGGTAAGGGAAGGGAGGAAGG + Intergenic
1061026858 9:128055372-128055394 GAAGAGAAGGGAAGGGAGGGAGG + Intergenic
1061056423 9:128225201-128225223 GAGAGGAAAGGAAGGGAGGCTGG - Intronic
1061085786 9:128397426-128397448 GAGAATAGGGGGAGGGGGGATGG + Intergenic
1061305660 9:129731640-129731662 GAAAAGAAAGGAAGGGAGGGAGG + Intergenic
1061440967 9:130603048-130603070 AAGAAACAGTGAAGGGAGGCTGG + Intronic
1061558840 9:131389576-131389598 GACAGTAGGGGAAGGGAGGCTGG + Intergenic
1061670357 9:132185033-132185055 GAGACAAAGGGAAGGGTGTCTGG + Intronic
1061725031 9:132577514-132577536 GAGGAGAAAGGAAGGGAGGGAGG + Intergenic
1061842441 9:133367133-133367155 GAGAAGAGGGGAATGGAGGGGGG + Intronic
1061942611 9:133891579-133891601 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
1062163878 9:135096035-135096057 GAGGATAAGGGGAGGGAGAGGGG - Intronic
1062192166 9:135253624-135253646 GAGCATGAGGGCGGGGAGGCTGG - Intergenic
1062329840 9:136034380-136034402 AAGAAAAAAGGAAGGGAGGAAGG + Intronic
1062449080 9:136608079-136608101 AAGAATAAAGGAGGGGAGGAGGG + Intergenic
1062751251 9:138255268-138255290 AAGAAAAAAGGAAGGGAGGAGGG - Intergenic
1185511604 X:668179-668201 GAGAAGAGGGGAGGGGAGGAGGG - Intergenic
1185598864 X:1325403-1325425 GAGGAGAGGGGAGGGGAGGCGGG + Intergenic
1185740185 X:2525842-2525864 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1185765678 X:2724012-2724034 GGGAAGAAGGGAAGGAAGGAAGG + Intronic
1185772208 X:2773365-2773387 AAGAATAAGGGAAGGACGGAGGG + Intronic
1185803235 X:3032370-3032392 AAGAAGAAAGGAAGGGAGGGAGG + Intronic
1185853788 X:3513361-3513383 GAGAATGAGGCAAAGGAGTCTGG + Intergenic
1185861535 X:3583914-3583936 GTGAAGAAAGGAAGGGAGGGAGG + Intergenic
1186020670 X:5251380-5251402 GAGAGGAAGGGAAGGAAGGAGGG + Intergenic
1186077610 X:5898013-5898035 GAGAAAGAAGGAAGGGAGGGAGG - Intronic
1186077645 X:5898188-5898210 AAGAAGAAGGGAAGGAAGGAGGG - Intronic
1186206323 X:7204627-7204649 GAGAAAAAAGGAAGAGAGGGAGG - Intergenic
1186240013 X:7555503-7555525 GAAAATAAGGGAAGGAGGGAAGG + Intergenic
1186729571 X:12394652-12394674 GAAAAAAAGAGAAGGGAGGGAGG - Intronic
1186776209 X:12867059-12867081 GAGATGAAGTGATGGGAGGCAGG - Intergenic
1186853275 X:13601431-13601453 GGGGAGAAGGGAAGGCAGGCAGG - Intronic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1187040773 X:15593385-15593407 GAGAAGAAAGGAAGGAAGGAAGG + Intronic
1187132231 X:16514120-16514142 GAGAAGGAGGGAAGGAAGGGAGG + Intergenic
1187231762 X:17430139-17430161 GAGAAAGAAGGAAGGAAGGCAGG - Intronic
1187480199 X:19648341-19648363 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1187485995 X:19704222-19704244 GCGAATAATAGAAAGGAGGCTGG + Intronic
1187538489 X:20166667-20166689 GAAAATGAGGGGAGGGAGGGAGG - Intronic
1187743231 X:22379315-22379337 TATAATATGGAAAGGGAGGCGGG - Intergenic
1187756620 X:22534556-22534578 TAAAATAAGGGAGGGGAGGAGGG - Intergenic
1187882874 X:23862847-23862869 GAGAAGGAGGGAGGGGAGGGAGG + Intronic
1187984615 X:24796860-24796882 GGGAATCAGGGAAGGGAAACAGG - Intronic
1188059053 X:25577620-25577642 GAGAGTCAGGGAAGGGAGATAGG - Intergenic
1188077362 X:25794622-25794644 AAGAAAAATGGAAGGGAGGGAGG - Intergenic
1188080328 X:25830942-25830964 TAGACTCAGGGAAGGGAGACTGG - Intergenic
1188535843 X:31195803-31195825 GAGAGGAAAGGAAGAGAGGCGGG + Intronic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188632438 X:32382063-32382085 GAGAATAAAGGAAGGGATTGAGG - Intronic
1188688816 X:33103605-33103627 GAGAGTCAGGGAAGGGAGATAGG - Intronic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1189229579 X:39441855-39441877 AGGAATCAGGGAAGTGAGGCAGG + Intergenic
1189232075 X:39460371-39460393 GAGCATAGGAGAGGGGAGGCAGG - Intergenic
1189500919 X:41557817-41557839 GACACTAAGGGAATGGAGCCTGG - Intronic
1189681968 X:43526399-43526421 CACAAAAAGGGAAGGGAGTCTGG + Intergenic
1190026737 X:46930809-46930831 GAGAATAAGGGTAAGTAGGAGGG - Intronic
1190082298 X:47366056-47366078 GAGAAGAGGGGAAAGGAGTCAGG - Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190708820 X:53050782-53050804 GAGGGTAGTGGAAGGGAGGCAGG + Intronic
1191021825 X:55868510-55868532 GAGAGTCAGGGAAGGGAGACAGG - Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191904843 X:66077086-66077108 GGGAAGAAGGGAAGGGAAGAAGG - Intergenic
1191904847 X:66077099-66077121 GGGAAGAAGGGAAGGGAAGAAGG - Intergenic
1192054854 X:67762808-67762830 TATTATAAGGGAAGGGAGGAAGG + Intergenic
1192103142 X:68287016-68287038 GAGAAAGAAGGAAGGAAGGCAGG + Intronic
1192177904 X:68897414-68897436 GAGCAGCAGGGAAGGGAGCCAGG - Intergenic
1192606012 X:72518733-72518755 GAGAGGAAGGGAAGAGAGGAGGG - Intronic
1192705808 X:73528006-73528028 GAGAGTCAGGGAAGGGAGATGGG - Intergenic
1192925288 X:75749220-75749242 GAGAATAAAAGAAGGGTGGGTGG - Intergenic
1193182930 X:78480045-78480067 GCTAATAAGGGAAAGGAGTCAGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193393211 X:80954162-80954184 GAGAGCAAGAGAAGGGAGGGAGG - Intergenic
1193861023 X:86667355-86667377 AAGAGGAAGGGAAGGGAGGGAGG + Intronic
1194128085 X:90045023-90045045 GAGAATTAGGGGCGGGAGACAGG + Intergenic
1194199179 X:90934229-90934251 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
1194670863 X:96730884-96730906 GAGAGTCAGTGAAGGGAGGTAGG + Intronic
1194721557 X:97346409-97346431 GAGAAGGAGGGAAGGGGGGAGGG - Intronic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195327150 X:103767026-103767048 GAGAGTCAGAGAAGGGAGACAGG + Intergenic
1196002723 X:110804010-110804032 GAGACTAAGGGAAGGGACTGCGG + Intergenic
1196025664 X:111039184-111039206 GTGAGCAAGGGAAGGGTGGCAGG - Intronic
1196114975 X:111989334-111989356 GTGAATAAGGGAAAGCATGCTGG - Intronic
1196212762 X:113013645-113013667 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
1197146928 X:123182164-123182186 GAGAAAGAGGGAAGGGAGTTTGG + Intergenic
1197670514 X:129272650-129272672 GAAAGTAAGGGAAGGGAGCAAGG - Intergenic
1197687076 X:129451997-129452019 GAGAATAAAAAAATGGAGGCTGG - Intronic
1197815980 X:130499280-130499302 GGGAATAAGGGAAGGAATGAAGG - Intergenic
1197816533 X:130504435-130504457 GGGAAGAAGGGAAGGAAGGAAGG - Intergenic
1197816570 X:130504562-130504584 GGGAAGAAGGGAAGGAAGGAAGG - Intergenic
1198087388 X:133293932-133293954 AAGAGTAAGGGCAGGGAGGTGGG - Intergenic
1198100043 X:133415309-133415331 GGGAAGGAGGGAAGGGTGGCAGG + Exonic
1198195132 X:134352510-134352532 GAAAAGAAAGGAAGGAAGGCAGG + Intergenic
1198204350 X:134452158-134452180 GAGAAGAGGGGGAGGGAGGGAGG + Intergenic
1198323424 X:135542531-135542553 GAGAAGGAGAGAAGGGAGGGAGG + Intronic
1198327199 X:135585474-135585496 GAGAAGAGGAGAAGGGAGGAAGG + Intergenic
1198927340 X:141814168-141814190 GAAAATAAGGGAAGAGAATCAGG - Intergenic
1199288374 X:146078576-146078598 GAGAATAGGGGTAGGGAGTGGGG + Intergenic
1199430352 X:147752805-147752827 GAGAAGGAGGGAAGAGAAGCAGG - Intergenic
1199619085 X:149683281-149683303 GAGAGTAAGCGAAGGGAGATAGG - Intergenic
1199704791 X:150414508-150414530 GAGAAAAAGTGAAGGAAGCCGGG - Intronic
1200103375 X:153699568-153699590 GAGCACAAGGGAAGGGCGACAGG + Intergenic
1200243676 X:154511427-154511449 GAGATAAAGGGAAGGAAGGGTGG + Intronic
1200428342 Y:3046832-3046854 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1200545173 Y:4510647-4510669 GAGAGTCAGGGAAGGGAGATAGG + Intergenic
1200780863 Y:7214254-7214276 GGGAACAAGGGAAGGGAGTGGGG + Intergenic
1200825904 Y:7640353-7640375 AAGAAGAAGGGAAGGAAGGAAGG - Intergenic
1200957047 Y:8960136-8960158 AAGAAGAAGGGAAGGAAGGAAGG + Intergenic
1201070421 Y:10143110-10143132 GAGAAGAAAGGAAGGCAGGAAGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201298485 Y:12485993-12486015 GAGAAAAGAGGAAGTGAGGCAGG - Intergenic
1201461537 Y:14230795-14230817 GGGAGGAAGGGAAGGCAGGCAGG + Intergenic
1201581860 Y:15518085-15518107 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1201690539 Y:16759913-16759935 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1201691846 Y:16775443-16775465 GAGACAGAGGGAAGTGAGGCAGG - Intergenic
1201741113 Y:17325497-17325519 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1201773892 Y:17644073-17644095 GGGGAAAAGGGAAGGAAGGCAGG + Intergenic
1201827665 Y:18261916-18261938 GGGGAAAAGGGAAGGAAGGCAGG - Intergenic
1201888956 Y:18920454-18920476 GGGAAGAAGGGAAGGAAGGAAGG + Intergenic
1202039165 Y:20664802-20664824 GAGAATAAGGGAATGGAGCTGGG - Intergenic
1202061808 Y:20896798-20896820 GAGAGTCAGTGAAGGGAGACAGG - Intergenic