ID: 1017679881

View in Genome Browser
Species Human (GRCh38)
Location 6:156852973-156852995
Sequence TATAATGCTGATAGGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017679876_1017679881 19 Left 1017679876 6:156852931-156852953 CCTCATGTCTTGGTGAGCTTGCT 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG 0: 1
1: 0
2: 3
3: 30
4: 249
1017679872_1017679881 30 Left 1017679872 6:156852920-156852942 CCCAAAGCTTCCCTCATGTCTTG 0: 1
1: 0
2: 1
3: 22
4: 286
Right 1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG 0: 1
1: 0
2: 3
3: 30
4: 249
1017679875_1017679881 20 Left 1017679875 6:156852930-156852952 CCCTCATGTCTTGGTGAGCTTGC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG 0: 1
1: 0
2: 3
3: 30
4: 249
1017679873_1017679881 29 Left 1017679873 6:156852921-156852943 CCAAAGCTTCCCTCATGTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 254
Right 1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG 0: 1
1: 0
2: 3
3: 30
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017679881 Original CRISPR TATAATGCTGATAGGGATAA TGG Intronic
904333098 1:29778368-29778390 AATAATGCTGCTATGAATAATGG + Intergenic
904413323 1:30338574-30338596 GATAATGGTGATAGTGATGATGG + Intergenic
904413350 1:30338986-30339008 GATGATGATGATAGTGATAATGG + Intergenic
904413352 1:30339001-30339023 GATAATGGTGATGGTGATAATGG + Intergenic
906955296 1:50369139-50369161 TATAATGATGATAGTGATGATGG + Intergenic
907350156 1:53822787-53822809 AATAATGATGATAATGATAATGG + Intronic
908211819 1:61908026-61908048 CATAATTCTGAGTGGGATAAGGG - Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909815093 1:79982820-79982842 TATAAGGCTAATAGGGATCGGGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
911771658 1:101750827-101750849 TTTAATGTTGGTAAGGATAAAGG - Intergenic
913563447 1:120046787-120046809 TATATTGCTGATTTGGATCAGGG - Intronic
913634676 1:120746790-120746812 TATATTGCTGATTTGGATCAGGG + Intergenic
914284041 1:146206151-146206173 TATATTGCTGATTTGGATCAGGG - Intronic
914545072 1:148656890-148656912 TATATTGCTGATTTGGATCAGGG - Intronic
914621495 1:149413798-149413820 TATATTGCTGATTTGGATCAGGG + Intergenic
915461891 1:156075467-156075489 TATAATGCCCATAGTGATGAAGG + Exonic
917538399 1:175891065-175891087 CATGATGCTGAGAGGGAAAATGG - Intergenic
918200565 1:182262429-182262451 TTGAAGGCTGATAGTGATAAGGG + Intergenic
918863420 1:189862295-189862317 AATAATGTTGATATGAATAACGG - Intergenic
919340859 1:196304699-196304721 GATAATGCTAATAGAGACAATGG - Intronic
921729293 1:218559233-218559255 TGTAATGATGATAGTGGTAATGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
923745966 1:236700559-236700581 AATAAACCTGATAGGGATGAGGG - Intronic
924596763 1:245452539-245452561 TATATTGCTGATGGGTAAAATGG - Intronic
1063151484 10:3340678-3340700 TAAAATGCTGTTATGCATAAAGG - Intergenic
1063444004 10:6097032-6097054 TTTAATGCTGAAAGGCAAAAGGG - Exonic
1063656484 10:7995396-7995418 TATAAAGGTCATAGGGAAAAAGG - Intronic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1071414606 10:85429366-85429388 GAAATTGCTGATAGGGAAAAGGG - Intergenic
1072671524 10:97433401-97433423 TATTATACTGATATGGAAAAAGG - Exonic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073598958 10:104828051-104828073 CTTATTGCTGATAGGGAAAAAGG - Intronic
1075067229 10:119297324-119297346 AATTATGGTGATAGTGATAATGG - Intronic
1077546696 11:3174388-3174410 TATGATGGTGATAGTGATGATGG - Intergenic
1078343498 11:10520959-10520981 TACAATGCTGACATTGATAATGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1081393140 11:42553540-42553562 TATTTTGATGAGAGGGATAATGG + Intergenic
1081554809 11:44148802-44148824 GATGATGCTGATAGTGATGATGG + Intronic
1083313709 11:61800935-61800957 TATTATACTGATAGGAATATAGG + Exonic
1084350293 11:68593111-68593133 CATGATGTTGATTGGGATAATGG - Intronic
1085863935 11:80266043-80266065 TATAATGATGATAGAGATAATGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088412526 11:109550886-109550908 GATACTGATGATAGTGATAATGG + Intergenic
1089507050 11:118970662-118970684 CATAGTGCTAAAAGGGATAACGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092278810 12:7083440-7083462 TGTAATGGTGATAGTGATGATGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093405683 12:18801306-18801328 TGCTATACTGATAGGGATAATGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1098828736 12:75332255-75332277 GATAAGGTTAATAGGGATAAAGG - Intronic
1098844004 12:75512885-75512907 TAGAGGGCTGATAGGGATTAAGG + Intergenic
1098859671 12:75693893-75693915 TATAATGCTGATGGTGACAGTGG - Intergenic
1099120088 12:78678902-78678924 GATAATGATGATAAGGATGATGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100336863 12:93639919-93639941 TATTATACTGATATGGAAAAAGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101361598 12:104032424-104032446 TATTATACTGATATGGAAAAAGG - Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101809956 12:108098924-108098946 TATAATGAGGATAGGGACACAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1109643167 13:65218524-65218546 CATATTGTTGAAAGGGATAAAGG + Intergenic
1110678485 13:78279051-78279073 TAGCATGCTGATAGGTATCAAGG + Intergenic
1111580551 13:90217454-90217476 GAAAATGATGATAGGGATGACGG + Intergenic
1111789472 13:92835833-92835855 CATATTGCTGATGGGGATACAGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114507520 14:23229328-23229350 AATAATGCTGGTAGGAATATTGG + Intronic
1116588771 14:46744290-46744312 TATAATGCGGATATGGAAAAAGG + Intergenic
1116618500 14:47168794-47168816 TAAAATGCTAATAAGGCTAATGG + Intronic
1117249593 14:53923090-53923112 TTTAATCATGATAGGGAAAAAGG + Intergenic
1118299936 14:64606245-64606267 GAGAATGCAGATAGGGAAAAAGG + Intergenic
1119139415 14:72252450-72252472 TATACTGCAGATAGATATAATGG - Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1122840223 14:104457727-104457749 TATAAAGGTGAGAGAGATAACGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124009587 15:25826814-25826836 AATAATGATGATAATGATAATGG + Intronic
1124045307 15:26144013-26144035 AATAATGCTGAAAGGGCTGAAGG + Intergenic
1124988978 15:34651836-34651858 GATGATGATGATAGTGATAAAGG + Intergenic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127685607 15:61340752-61340774 TATATTCCTGATAGAGATTAAGG + Intergenic
1129113976 15:73354754-73354776 GATGATGATGATGGGGATAATGG - Intronic
1130633350 15:85592404-85592426 TATAATGCTGATATTCAAAATGG + Intronic
1130751120 15:86714246-86714268 TTTACTGGTGACAGGGATAAAGG + Intronic
1132167667 15:99611719-99611741 AATAATGCTGCTATGAATAACGG - Intronic
1132291864 15:100709481-100709503 TATTCTGCTGATAAGAATAAAGG - Intergenic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1135875486 16:26196174-26196196 TATAATGCCTATCTGGATAATGG + Intergenic
1136071328 16:27789262-27789284 GATAATGCAGAAATGGATAATGG + Exonic
1136695935 16:32082094-32082116 TTTAATTTTGATATGGATAAGGG - Intergenic
1136796430 16:33025347-33025369 TTTAATTTTGATATGGATAAGGG - Intergenic
1138240366 16:55422766-55422788 AATAATGCTGATAGAGTTATTGG - Intronic
1138856825 16:60704071-60704093 TATAACGTAGATAGTGATAATGG - Intergenic
1138919939 16:61515192-61515214 TATAATTCTTATAGTGATATAGG + Intergenic
1139143374 16:64295412-64295434 AATAATGCTGCTATGGACAAGGG + Intergenic
1140413640 16:74757612-74757634 TATATTGCTGATATGGAAAGAGG + Intronic
1141813647 16:86393892-86393914 AATGATGGTGATAGTGATAATGG - Intergenic
1141931830 16:87210284-87210306 GATAATGGTGATGGTGATAATGG + Intronic
1145732884 17:27205809-27205831 CACAATGCTGATAGGCAGAATGG + Intergenic
1146050632 17:29549856-29549878 TAAAATGCTGTTAGGAAGAAGGG - Exonic
1146505160 17:33398540-33398562 AATAATGATGATGGGGATGATGG + Intronic
1148001181 17:44388238-44388260 TATAATGTTGATGGAGATGAGGG + Intronic
1149280372 17:55098001-55098023 TATAATGATGATGATGATAATGG - Intronic
1150245184 17:63669433-63669455 TATAATGGTGATGGGTATAAGGG - Intronic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1153209278 18:2742102-2742124 TAACATGCTGATAGGTCTAATGG - Intronic
1155924373 18:31638942-31638964 TATAAAGCTGAGAGGTAGAAGGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157305816 18:46516863-46516885 GATGATGGTGATAGGGATGAAGG - Intronic
1158285148 18:55872515-55872537 CATCATGCTGTTAGGAATAAAGG - Intergenic
1158754219 18:60302709-60302731 TATAATGCTGATAGTGTTGATGG + Intergenic
1160143180 18:76344242-76344264 AATAATGGTGATAGTGATGATGG + Intergenic
1163486657 19:17591555-17591577 TACAATGATGATAGGGACGACGG + Intergenic
1164396799 19:27872577-27872599 TATGATGATGATAGTGATGATGG + Intergenic
1164698428 19:30264200-30264222 TAGAATACTGATGGGGATAGAGG - Intronic
1165293997 19:34911437-34911459 AAGAATGGTGATAGGGATAAGGG + Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
926112085 2:10189929-10189951 GATGATGGTGATAGTGATAATGG + Intronic
926112246 2:10190856-10190878 TACAATGCTGAGAGTGATGATGG + Intronic
927797540 2:26063285-26063307 TAAAAAGCTGAAAGGGAAAAGGG - Intronic
929089654 2:38202436-38202458 TAGAATCCTAATAGGGATAAGGG - Intergenic
929483635 2:42336239-42336261 TATATTGCTAACAGGGAGAAGGG - Intronic
929695198 2:44108807-44108829 TAAAATGTTGATAGGTATAACGG + Intergenic
930843673 2:55877438-55877460 TATAATGCTGAAAGTGCCAAAGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
932113504 2:69023380-69023402 GATGATGGTGATAAGGATAATGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937195527 2:120152095-120152117 TTTATTCCTGAAAGGGATAAAGG + Intronic
937518533 2:122683553-122683575 TAAAATACTGAAATGGATAAAGG - Intergenic
937569897 2:123343952-123343974 AATAATGCTGATATGAATATGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
939137084 2:138309990-138310012 TTTAATCCTGAGGGGGATAAAGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
942258943 2:174138019-174138041 TTTATTGCTGATAGGGAGAAAGG - Intronic
943193720 2:184716028-184716050 TACAAAACTGATAGGAATAATGG - Intronic
943378997 2:187119697-187119719 ATTAATTCTGATAGGGATGATGG + Intergenic
945467748 2:210189502-210189524 TATATTCCTGATAGTGATAGTGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1168871885 20:1135960-1135982 CATACTGTTGGTAGGGATAAGGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1174927543 20:54777219-54777241 GAAAATGCAGATAGGGAAAAAGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1182389461 22:29979833-29979855 TATAATGTTGATTTGCATAATGG + Intronic
1183577153 22:38699193-38699215 TATTATGCTGATAGGCAGAAAGG - Intronic
949780979 3:7687909-7687931 GATCATGTTGATAGGGAAAAAGG - Intronic
950129089 3:10529639-10529661 AATCATTATGATAGGGATAAGGG + Intronic
950608255 3:14104316-14104338 TATAATGAGGATAGAGATCATGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951437707 3:22684261-22684283 TATAATGCTGATAATTATACAGG - Intergenic
953847772 3:46442316-46442338 TATAAGGATGATAGAAATAAAGG + Intronic
955623033 3:60886463-60886485 TGTAATACTCATAGGGACAATGG + Intronic
955885559 3:63594741-63594763 GATAATGATGATAGTGTTAATGG - Intronic
956018106 3:64905645-64905667 TATAATGCTGAAACAGTTAAGGG + Intergenic
957081112 3:75636449-75636471 TATAATGGTTATAGAGAAAACGG + Intergenic
957299433 3:78372208-78372230 AATAATACTTATAGGCATAAAGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
961619726 3:128214182-128214204 TATAATGCTGATATATAAAAAGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963842705 3:150123865-150123887 AATAATGCTGGGAGGGAGAAGGG + Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965315637 3:167186783-167186805 TATATTGCTGATACAGATAGAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971076040 4:23151293-23151315 TATAGTGCTGGTAGGGACAAGGG + Intergenic
971779605 4:31015637-31015659 TATAATGCAGACATGGGTAAAGG - Intronic
971804385 4:31336301-31336323 TATAATGCTGAAAGGTGGAAAGG + Intergenic
972709820 4:41583995-41584017 TGTAAATATGATAGGGATAATGG + Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975435848 4:74350364-74350386 TATAATGCTGTTGAGGAAAAAGG - Intergenic
976799155 4:88968861-88968883 TATAACGCTGTTAGGGATTTTGG + Intronic
977338212 4:95724652-95724674 AAGAATGGTGATAGGGAGAAAGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979027681 4:115597625-115597647 TATACAGCTCATAGGGAGAAGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984569815 4:181378534-181378556 AATATTGCAGAAAGGGATAAAGG - Intergenic
986120235 5:4828487-4828509 TATAATGTTTATAGTGATAGAGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
989792135 5:45418460-45418482 AATAATGCTGATAGCATTAATGG + Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
993011934 5:82492755-82492777 TATGATGCTGAGAGGCAGAAGGG - Intergenic
993530365 5:89017247-89017269 AATAATGATGATGGGGATGATGG - Intergenic
993686996 5:90949999-90950021 TAAGATGCTGATAGGGATCATGG - Intronic
993937614 5:94023281-94023303 TATGGTGCTGATAGTGATATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
996182332 5:120434374-120434396 GATAATGCTAATATGAATAATGG - Intergenic
998034081 5:138898736-138898758 GACAATGCTGAAAGAGATAATGG - Intronic
1000208794 5:159091052-159091074 TATATTGCTGAGAGCGATGAAGG - Intronic
1000262771 5:159604090-159604112 TTTAATGTTGATAGGGATATAGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000988268 5:167884697-167884719 AATAATGCTGCTAGGAATATTGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1004422599 6:15485259-15485281 GATAATCCAGATGGGGATAATGG + Intronic
1004487842 6:16084260-16084282 GATAATGCTGATCTGGATGATGG - Intergenic
1004545058 6:16589706-16589728 AACAATACTGATAGTGATAATGG - Intronic
1004904441 6:20223241-20223263 TATGATGGTGATAAGGACAAAGG + Intergenic
1006211419 6:32398608-32398630 TAAAATCCTCATATGGATAAAGG - Intronic
1008026263 6:46639600-46639622 TATTATGTTGAAAGGGAAAATGG - Exonic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011626837 6:89290079-89290101 TAAAATGCTGATGGGCCTAATGG - Intronic
1012379296 6:98600904-98600926 TATAATGATGACAGTGATAAGGG - Intergenic
1014364935 6:120527798-120527820 TCTAATGCTGACAGGGATAAGGG + Intergenic
1014645307 6:123965683-123965705 TAGTATTCTGATAGGGATAAGGG - Intronic
1015629976 6:135222435-135222457 TATAATCAGAATAGGGATAACGG + Intergenic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1018467660 6:164065917-164065939 TATAAAGCCAATAGGTATAATGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019490206 7:1309242-1309264 GATAATGGTGATAGTGGTAATGG + Intergenic
1020310417 7:6863303-6863325 AATAATGCTGCTATGGATATGGG + Intergenic
1023066913 7:36387642-36387664 AATGATGATGATAGTGATAATGG - Intronic
1023166586 7:37349245-37349267 TATAATGATGATGGGGATAGTGG + Intronic
1023297150 7:38727279-38727301 TATAATGATTATAGGGGTTAGGG - Intronic
1023417290 7:39945440-39945462 TATAATGCTGATGACGATATAGG - Intergenic
1024348954 7:48343402-48343424 TATAAAGCTGATACCGATTAGGG + Intronic
1027801525 7:82757250-82757272 AATAATGCTGATAGAGAAGAGGG + Exonic
1030372462 7:108715860-108715882 TATGCTGCTGCCAGGGATAAAGG + Intergenic
1030961973 7:115934865-115934887 TAAATTGCTAATAGGCATAATGG - Intergenic
1031081587 7:117263484-117263506 TTTAATGAAGATTGGGATAAGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031682906 7:124696126-124696148 TATGATGCAGATAGAAATAAAGG - Intergenic
1038382510 8:27109825-27109847 TAAAATGCTGATGGGGATGAGGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1041658857 8:60381273-60381295 TATGCTGCTGATAGGAAGAAAGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1048556770 8:135485693-135485715 AATAATGATGATAAAGATAAGGG + Intronic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1050503592 9:6324156-6324178 TATAATGGTGGTAGGGGTACTGG - Intergenic
1051086242 9:13352047-13352069 TATAGTTATGATAGGCATAAAGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1053005259 9:34600112-34600134 GATAATGTTGATAGAGAAAATGG - Intergenic
1053053730 9:34981297-34981319 CATAATGGTGACAGGAATAAGGG - Exonic
1055108099 9:72533239-72533261 TATAATGCATAAAGTGATAAAGG + Intronic
1055719336 9:79154143-79154165 TTTTATCCTGATAGTGATAAGGG - Intergenic
1058050571 9:100402066-100402088 GAAAATGCTGGTAGGGATCAGGG - Intergenic
1058127692 9:101214608-101214630 AATAATGCTGATAGAATTAAAGG - Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1061172831 9:128971027-128971049 TATAATGGTGGTGTGGATAATGG + Intronic
1185683083 X:1904968-1904990 GATGATGCTGATGGAGATAATGG + Intergenic
1185683091 X:1905043-1905065 AATGATGGTGATAGTGATAATGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188472933 X:30560629-30560651 TATAATAGTGATAGGTAAAAAGG + Intronic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189432376 X:40959057-40959079 TAGAATGCTGAGAGGGAGAATGG - Intergenic
1190018157 X:46846653-46846675 TATACTGCTGGTAGGCAAAATGG - Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191965584 X:66753563-66753585 TATAATGTTGATCGTGATGATGG - Intergenic
1192388199 X:70695526-70695548 TATTATCCTGATTGCGATAATGG + Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1197966703 X:132070963-132070985 TATTAAGCTGAAAGGTATAAAGG - Intergenic
1198369423 X:135975327-135975349 TAGAATTCTGATTGGGTTAAAGG - Intergenic
1198730372 X:139721674-139721696 CATGATGCAGATAGGGATAATGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201669555 Y:16503111-16503133 GATGATGGTGATAGGGATGATGG - Intergenic