ID: 1017680698

View in Genome Browser
Species Human (GRCh38)
Location 6:156861370-156861392
Sequence GCCGGTGAATTGCTGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017680695_1017680698 -1 Left 1017680695 6:156861348-156861370 CCTAGCACTTTGGGAGGCTGATG 0: 727
1: 97170
2: 219971
3: 241690
4: 263944
Right 1017680698 6:156861370-156861392 GCCGGTGAATTGCTGGACACAGG No data
1017680693_1017680698 7 Left 1017680693 6:156861340-156861362 CCTCTAATCCTAGCACTTTGGGA 0: 216
1: 27562
2: 341011
3: 248466
4: 127582
Right 1017680698 6:156861370-156861392 GCCGGTGAATTGCTGGACACAGG No data
1017680690_1017680698 26 Left 1017680690 6:156861321-156861343 CCAGGCGTGGTGGTTCATGCCTC 0: 3
1: 407
2: 12305
3: 67251
4: 158660
Right 1017680698 6:156861370-156861392 GCCGGTGAATTGCTGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017680698 Original CRISPR GCCGGTGAATTGCTGGACAC AGG Intronic
No off target data available for this crispr