ID: 1017681478

View in Genome Browser
Species Human (GRCh38)
Location 6:156868558-156868580
Sequence CATTGGGCTGTGTCCTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017681473_1017681478 -4 Left 1017681473 6:156868539-156868561 CCTGGTTCCGGGACTGTGCCATT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1017681478 6:156868558-156868580 CATTGGGCTGTGTCCTCCTATGG 0: 1
1: 0
2: 0
3: 21
4: 234
1017681472_1017681478 3 Left 1017681472 6:156868532-156868554 CCTGTTTCCTGGTTCCGGGACTG 0: 1
1: 0
2: 0
3: 10
4: 183
Right 1017681478 6:156868558-156868580 CATTGGGCTGTGTCCTCCTATGG 0: 1
1: 0
2: 0
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017681478 Original CRISPR CATTGGGCTGTGTCCTCCTA TGG Intronic
901318382 1:8324113-8324135 CACTGGGCTTTGGCCTCCTGGGG + Intronic
901470592 1:9453850-9453872 CTCTGGGCTGTGTCCACCTCTGG - Intergenic
902100904 1:13987932-13987954 CTTTGTGCTGTGTCATCCCATGG + Intergenic
902159729 1:14520289-14520311 CATTGGGCTGTGGCCACCGGAGG - Intergenic
902757966 1:18561903-18561925 CGCTGGGCTGTGCCCTCCTGTGG - Intergenic
903551843 1:24162615-24162637 CTTTGTGCTGTGTCATCCCATGG + Intronic
903796343 1:25931702-25931724 CATTGCCCTATGTCCTACTAAGG + Intergenic
904433295 1:30478970-30478992 CTCTGGGCTGTGTCCTCCAGAGG + Intergenic
908546038 1:65163043-65163065 ACTTGGGCTGTTTCCTGCTATGG + Intronic
909802746 1:79833020-79833042 CATGGGGCTGAGTATTCCTAGGG - Intergenic
910282414 1:85515989-85516011 CTTAGTGCTGTGTCCTCATATGG + Intronic
913551372 1:119920180-119920202 CACTGGGCTGTGTCTGCCCATGG - Intronic
914207677 1:145547901-145547923 CTTAGTGCTGTGTCCTCATATGG - Intergenic
916021199 1:160793992-160794014 TATAAGGCTGTGTCCTCCTATGG + Intergenic
917666510 1:177230466-177230488 CATTTGACTCTGACCTCCTACGG - Intronic
920174979 1:204095052-204095074 CATTGTGCTGTGTCCTCTCCAGG + Intronic
920218693 1:204379429-204379451 CATTGGACTGTGTGCTCCTTGGG + Intergenic
920839033 1:209538308-209538330 CACTGGACTGTGTCCTACTTTGG + Intergenic
923428450 1:233895289-233895311 CTTTGTGCATTGTCCTCCTAGGG - Intergenic
924596633 1:245450961-245450983 CTTTGGGGTGTGTCTTCCTATGG + Intronic
1063113387 10:3055536-3055558 CTTTGTGCTGTGTCATCCCACGG + Intergenic
1064669460 10:17695976-17695998 CATTTTGCTGTGTCCTCCCATGG + Intronic
1065644741 10:27822524-27822546 CTTTGGACTGTGTCCGCCTATGG + Intronic
1066383685 10:34922832-34922854 CTTTGTGCTGTGTCCTCACATGG + Intergenic
1067131922 10:43573389-43573411 CAGTGGGCTGTGCCCTCCTGGGG - Intronic
1067458498 10:46440448-46440470 CTTCTTGCTGTGTCCTCCTATGG - Intergenic
1067628700 10:47944187-47944209 CTTCTTGCTGTGTCCTCCTATGG + Intergenic
1068033611 10:51732995-51733017 CCTTTGGCTGTGTCCTCAAATGG + Intronic
1072569670 10:96647775-96647797 CATGGGGCTGTGACCTCACAGGG - Intronic
1075569023 10:123525681-123525703 CATTGATATGTGTCCTACTAAGG + Intergenic
1076759296 10:132592932-132592954 CAGTGGGCTGTGTTCTCATCTGG + Intronic
1077422816 11:2460927-2460949 CATGGGGGTGTGGCCTCCTGTGG + Intronic
1079240189 11:18717027-18717049 CATTGGGCTGGTCCCTCCTGAGG + Intronic
1080054887 11:27896260-27896282 CATTGGGCTGGGTCTTTCTCTGG + Intergenic
1083033002 11:59611469-59611491 CATTGGGCTGAGTTCTCATTTGG - Intronic
1084748968 11:71191402-71191424 CACAGGGCTGGGTCCTCCTGAGG + Intronic
1086223265 11:84475866-84475888 CATGGTACTGTGACCTCCTAGGG + Intronic
1087825628 11:102761926-102761948 CATTGGACTGTGACTTCCTGCGG - Intergenic
1090660550 11:128878940-128878962 CACTGGCCTGTGTCTTTCTACGG + Intergenic
1093068697 12:14686193-14686215 GGATGGGCTGTGTCCTCATAGGG - Exonic
1095511852 12:42959574-42959596 CATCTAGCTGTGTCCTCCCAGGG - Intergenic
1095665290 12:44789684-44789706 CATTGGGCTTTGTCTTTCTCTGG - Intronic
1096750076 12:53752926-53752948 CATGGGACTGTGTCCTCTTGGGG + Intergenic
1098601496 12:72336679-72336701 CTTTGTGCTGTGTCATCCCATGG + Intronic
1099614979 12:84922743-84922765 CTTTTTGCTGTGTCCTCATATGG + Intergenic
1100303406 12:93328326-93328348 CATCTGGCTGTGTCCTCACATGG - Intergenic
1101148530 12:101864187-101864209 CATCTTGCTGTGTCCTCCCAGGG - Intergenic
1101555575 12:105805780-105805802 CACTGGACTTTGTCCTCCTCTGG - Intergenic
1102295542 12:111733769-111733791 CCCTGGGCTGTGTGCTCCAAAGG - Intronic
1102686991 12:114732536-114732558 CAATGGGCAGTGTCCTCACATGG + Intergenic
1104956405 12:132468516-132468538 CACTGGGCTGTGCACTCCTGAGG - Intergenic
1106732196 13:32552828-32552850 CATTTAGCTGTGTCCTCACATGG - Intergenic
1108249319 13:48549274-48549296 CTTCTTGCTGTGTCCTCCTATGG - Intergenic
1110486445 13:76050446-76050468 CATTTTGCTGTGTCCTCATATGG + Intergenic
1110487302 13:76061558-76061580 CTTTGTGCTGTGTCATCCCATGG - Intergenic
1110531379 13:76602604-76602626 CAATGTGCTGTGTCTTCTTATGG - Intergenic
1110799283 13:79676146-79676168 CATTGAGGAGTGTCCTCCGAAGG - Intergenic
1116088883 14:40278645-40278667 CATTGGGCTTTGCCTTCCTCTGG + Intergenic
1116730991 14:48622418-48622440 CATTGAGCTTTGTCTTCCTTTGG + Intergenic
1118713016 14:68538184-68538206 CATTTGAGTCTGTCCTCCTAAGG + Intronic
1119398988 14:74349211-74349233 CTTTGGGCTGTGACTTCCCAAGG - Intronic
1121051126 14:90819634-90819656 CATTGGGATGTTTCATCCTAAGG - Intergenic
1121097688 14:91229234-91229256 CCTTGGGCTGGGCCCTGCTAAGG - Intergenic
1121825192 14:97004485-97004507 CTTTGGGCTGTGTCCTCACATGG - Intergenic
1123123785 14:105930233-105930255 CCCTGGGCTGTGTGCTCTTATGG + Intronic
1123123823 14:105930377-105930399 CCCTGGGCTGTGTCCTCCCCTGG + Intronic
1123123840 14:105930425-105930447 CCCTGGGCTGTGTCCTCCCCTGG + Intronic
1126428877 15:48559457-48559479 CCTTGGTCTGTGTCCTCCGCAGG - Intronic
1126572837 15:50169740-50169762 CATTGGGCTTTGTCTTTCTCTGG - Intronic
1126634514 15:50767708-50767730 CTTTGGGCTTTGTCCTGCCAGGG + Intergenic
1127477352 15:59347218-59347240 CAATGGGCTTTGTGCTTCTATGG - Intronic
1127554449 15:60073671-60073693 CTTTTTGCTGTGTCCTCCCATGG + Intergenic
1130938231 15:88487959-88487981 CTTTGTGCTGTGTCATCCCATGG + Intergenic
1133115999 16:3578384-3578406 CATTCTGCTGTTTCCTCTTAGGG - Intergenic
1133827345 16:9290203-9290225 CTTTGTGCTGTGTCGTCCCATGG + Intergenic
1133834444 16:9353893-9353915 CATTCTTCTGTGTCCTCCTTTGG - Intergenic
1137934025 16:52616802-52616824 CAGTGGGCTGTGTGGTCCTGCGG + Intergenic
1137983049 16:53085847-53085869 TATTGAGGTGTGTTCTCCTAAGG + Intronic
1138793541 16:59939362-59939384 CATTTTGCTGTGTCCTCAAATGG - Intergenic
1140782811 16:78312050-78312072 CATTGGGCTGACTCCTTCAATGG + Intronic
1141149583 16:81554929-81554951 CATTGGGCTGGAAGCTCCTAGGG + Intronic
1141192060 16:81832056-81832078 CAGTGGGCTTTGTCGTCCTCCGG + Intronic
1143318406 17:6050912-6050934 CATTGGGTTGTTTCCACCTTTGG + Intronic
1144644311 17:16961323-16961345 GATTGGGCTGTTTCCACCTTTGG - Intronic
1145204763 17:20977659-20977681 GATTGGGCTGTTTCCACCTTTGG + Intergenic
1148408136 17:47438721-47438743 CATTGGGCTTTGTCTTTCTCTGG + Intronic
1148442591 17:47719477-47719499 CCTTGGGCTGGGTCGTGCTAGGG + Intergenic
1150505470 17:65693888-65693910 CTTTGTACTGTGTCCTCCCATGG - Intronic
1150755676 17:67910271-67910293 CATTGGGCTGTTTCCTCTTTTGG + Intronic
1152304089 17:79511161-79511183 ACCTGGGCTGTGTCCTCCTGAGG + Intronic
1153236222 18:2990977-2990999 CATTGGCATGTGGCCTCCCATGG - Intronic
1154074700 18:11188751-11188773 CATTGTGCTGTATCCTCCCTGGG - Intergenic
1155224797 18:23719874-23719896 GATTGGGCTGTGTCCACCCGGGG - Intronic
1155950030 18:31901786-31901808 CATTTGGATTTGTCCTCCTTTGG + Intronic
1156092024 18:33482822-33482844 CTTTGGGCTGAGTCATCCCAAGG + Intergenic
1156461607 18:37324409-37324431 CTTCTCGCTGTGTCCTCCTATGG - Intronic
1157114267 18:44848364-44848386 CCTGGGTCTGTGCCCTCCTATGG + Intronic
1157751252 18:50180253-50180275 CACTGGGCTGTGGCTTCCCAAGG + Intronic
1159545061 18:69830468-69830490 CTTTGTGCTGTGTCCTCACACGG - Intronic
1159651122 18:70980738-70980760 CTTCTGGCTGTGTCCTCATATGG + Intergenic
1160697415 19:491742-491764 CCTGGGGCTGTCTCCTCCCAGGG - Intronic
1160697470 19:491875-491897 CCTGGGGCTGTCTCCTCCCAGGG - Intronic
1160697498 19:491941-491963 CCTGGGGCTGTCTCCTCCCAGGG - Intronic
1160697553 19:492074-492096 CCTGGGGCTGTCTCCTCCCAGGG - Intronic
1161946871 19:7442847-7442869 CATCTGGCTGTGTCCTCACAAGG + Intronic
1162068250 19:8138418-8138440 CCCTGAGCTGTGTCCTCCTCGGG - Exonic
1162732834 19:12729229-12729251 CATGGGGCTGTGTGCTCCACTGG - Intergenic
1166172644 19:41042305-41042327 CTTTGTGCTGTGTCCTCACATGG - Intergenic
1167640838 19:50680501-50680523 TCTTGGGCTGTCTCCTCCTAGGG - Intronic
1168327302 19:55544933-55544955 GCTGTGGCTGTGTCCTCCTACGG + Exonic
924980817 2:219461-219483 CATCTGGCTGTGTCCTCACAAGG - Intronic
926921425 2:17944296-17944318 CATTGGACACTGTCCTCCCATGG + Intronic
927027158 2:19080285-19080307 CTGTGTGCTGTGTCCTCATAAGG + Intergenic
928865886 2:35917319-35917341 CATGAGTCTGTGTTCTCCTATGG - Intergenic
930682446 2:54271490-54271512 CAGTGTGCTGAGTCCTCCTTTGG - Intronic
932220489 2:69995434-69995456 CATTGAGGTGTGTCCTGCTTGGG + Intergenic
932546463 2:72715898-72715920 CATTGGACTGTTGCCCCCTAAGG + Intronic
933781059 2:85801568-85801590 CTTTTTGCTGTGTCCTCATATGG - Intergenic
933793931 2:85905244-85905266 CATTGCCCTCTGTCATCCTAAGG + Intergenic
933843895 2:86309667-86309689 CTTTTGGCTGTGTCCTCACATGG + Intronic
935089524 2:99881172-99881194 CTTTGTGCTGTGTCCTCTTCTGG - Intronic
935563174 2:104579047-104579069 CTTTGTGCTGTGTCCTCACATGG + Intergenic
936728323 2:115350416-115350438 CATTCTGCTGTTTCCTACTATGG + Intronic
938388222 2:130882851-130882873 CAATGGGCTGAGTCCCCCGAGGG + Intronic
941169119 2:162116294-162116316 CATTTGGCTGTGTCCTCAGATGG - Intergenic
943440695 2:187924150-187924172 CTTTGGACTGGGTCCTCCTAAGG + Intergenic
944037685 2:195315395-195315417 CATTGAGCTGTGCCCTGCAAAGG - Intergenic
944534551 2:200696222-200696244 CATTGGCCTGTGAGCTCCTTAGG - Intergenic
945768088 2:214004702-214004724 AATGGGGCTGGGTCATCCTAGGG + Intronic
946447917 2:219755367-219755389 CATCATGCTGTGTCCTCATATGG - Intergenic
946466880 2:219919887-219919909 AATGGGGCTTTGTCCTCCCAAGG - Intergenic
946620197 2:221553553-221553575 CATTTGGCTATGTTCTCCCAGGG - Intronic
948777929 2:240299464-240299486 CACTGGGCAGTGCCCTCCCAGGG + Intergenic
1169376310 20:5069230-5069252 CCTTGAGCTGAGTCCTCCTTCGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1170946813 20:20898782-20898804 CTTCTGGCTGTGTCCTCATATGG - Intergenic
1171049128 20:21839233-21839255 CATTGGGCTGAGGCTTTCTATGG - Intergenic
1172746834 20:37217238-37217260 CACTGGGCTGAGAACTCCTATGG + Intronic
1173292753 20:41728799-41728821 CCTTGTGCTGTGTCATCTTATGG - Intergenic
1176349719 21:5782895-5782917 AATTGCTCTGTGTCCTCCGAAGG + Intergenic
1176356533 21:5903479-5903501 AATTGCTCTGTGTCCTCCGAAGG + Intergenic
1176544040 21:8180965-8180987 AATTGCTCTGTGTCCTCCGAAGG + Intergenic
1176562991 21:8364010-8364032 AATTGCTCTGTGTCCTCCGAAGG + Intergenic
1176935339 21:14860659-14860681 CACTGGGCTGTGCCCTAGTAAGG + Intergenic
1177094074 21:16809400-16809422 CATCTAGCTGTGTCCTCCCATGG - Intergenic
1178500642 21:33123295-33123317 CTTTGGACTCTGTCCTCCTCTGG + Intergenic
1178755490 21:35345572-35345594 AATTGGGCTGCGGCCACCTACGG - Intronic
1179049173 21:37874147-37874169 CATTGGGCTGGGTGCTACTGCGG - Intronic
1179254535 21:39703770-39703792 CTTTGTGCTGTGTCATCCCATGG - Intergenic
1179421017 21:41236830-41236852 GATTGGGTTGTGTCCTTCAAAGG + Intronic
1180868055 22:19130962-19130984 CATTGGTCTTTGTCCCACTAGGG - Exonic
1181826653 22:25521978-25522000 CTTTGTGCTGTGTCATCCCATGG + Intergenic
1181887689 22:26034577-26034599 CATATGGCTGTGCCCTGCTATGG + Intergenic
1203248908 22_KI270733v1_random:97188-97210 AATTGCTCTGTGTCCTCCGAAGG + Intergenic
950497399 3:13341980-13342002 CATTGGTGTGAGTTCTCCTAGGG - Exonic
954082032 3:48218104-48218126 CATTGGGCTCTGCCCTCAGAGGG - Intergenic
955757739 3:62242858-62242880 CACTGGGATCTGTCCTCCTCTGG - Intronic
958723046 3:97869550-97869572 CATTGGGCTCTGTCTTCATAAGG + Intronic
959568007 3:107852508-107852530 CTTTCTGCTGTGTCCTCCCATGG - Intergenic
961669369 3:128517832-128517854 CATAGGGCTGTGTGCTGCCAAGG - Intergenic
961751170 3:129095688-129095710 CAATGGGCAGAGTCCTCCCATGG + Intronic
965865415 3:173199367-173199389 CCTTGGGCAGTGTCCTGTTAGGG + Intergenic
967127960 3:186442849-186442871 CTTTGAGCTGTGCCCTCCCATGG + Intergenic
968434704 4:578466-578488 GATGGGGCTGTGCCCTCTTAGGG + Intergenic
969010492 4:4057970-4057992 CATGGGCCTGTGGCCTCCCATGG - Intergenic
969743569 4:9051926-9051948 CATGGGCATGTGGCCTCCTAGGG + Intergenic
969990744 4:11260006-11260028 AATTGTGCTGTGTCCTCTGAAGG - Intergenic
970133144 4:12893180-12893202 CATTGGGCAGTGGGCTCCTTTGG + Intergenic
971394720 4:26217352-26217374 CATTCAGCTGTGTGCTCCTGTGG + Intronic
974007748 4:56575592-56575614 CATTGGGCTGTGACAGCCTCTGG - Exonic
974199077 4:58615286-58615308 CCTTGTGCTGTGTCCTCCAGAGG - Intergenic
978499737 4:109396519-109396541 CATTGGGTTGTTTCCACCTTTGG - Intergenic
979200270 4:117969335-117969357 CTTTTTGCTGTGTCCCCCTATGG - Intergenic
980319258 4:131247432-131247454 AGTAGGGCTGTGTCCTTCTAAGG + Intergenic
980615671 4:135220805-135220827 TATTGAGCTTTGTCATCCTAAGG - Intergenic
986240873 5:5958571-5958593 TATTGGGTTGCTTCCTCCTATGG + Intergenic
986589847 5:9357270-9357292 AATTGGACTGTGTCCACCAAAGG + Intronic
987414242 5:17646742-17646764 CATTGGGCTTTGTCTTTCTCTGG + Intergenic
992778908 5:80110652-80110674 AATTGAGCTGTGCCCACCTATGG - Intergenic
993488420 5:88515456-88515478 CTTTGCGCTGTGTCCTCACATGG + Intergenic
995572471 5:113494865-113494887 CTTTTTGCTGTGTCCTCCCATGG + Intergenic
999313966 5:150572165-150572187 CATTGGGCTGTTTCCTTGTAAGG + Intergenic
999673488 5:153977359-153977381 CATAGGGCTGAGTGCTCCTCAGG - Intergenic
1001707250 5:173750481-173750503 CATTAGGGTGTGCCCTCCTCTGG + Intergenic
1003017048 6:2476498-2476520 CATTGAGCTGTTTGCTCCTGTGG - Intergenic
1003114044 6:3271568-3271590 CCATGGGCTGTGTCCTTCCAGGG - Exonic
1003678145 6:8226071-8226093 CATGGGGCTGTCATCTCCTATGG + Intergenic
1004072112 6:12309230-12309252 CTTTTCGCTGTGTCCTCCCATGG - Intergenic
1004742218 6:18473026-18473048 GATGGGGCTGTGTTCTCCTCTGG + Intergenic
1005768423 6:29038856-29038878 AATGGGCCTGTGTCCTACTATGG - Intergenic
1006844422 6:37052380-37052402 CATAGGGGTGTGTCCTCCCTTGG - Intergenic
1007972229 6:46063761-46063783 CATTGGGCAGAGTCCTCGGAAGG + Intronic
1010607657 6:77911051-77911073 CATTTGTATGTCTCCTCCTAAGG + Intronic
1011313835 6:86009655-86009677 CTTAGTGATGTGTCCTCCTAAGG - Intergenic
1011859603 6:91738257-91738279 CATTCTGCTGTGTCCTCACATGG + Intergenic
1013777309 6:113692658-113692680 CATTGACCTGTGTCCTTCTGAGG - Intergenic
1015972056 6:138752222-138752244 CTTTGTGCTGTCTCCCCCTATGG - Intronic
1016384284 6:143515583-143515605 CATAGGGCTGTGTAATCCTGGGG + Intergenic
1017416112 6:154222608-154222630 CTTTGGGCTGTTTCCTTCTCAGG + Intronic
1017433301 6:154392387-154392409 CATTGGGCTGTGTTCTACAAAGG + Exonic
1017681478 6:156868558-156868580 CATTGGGCTGTGTCCTCCTATGG + Intronic
1018039278 6:159907404-159907426 CATTGGTCTGTGCCCTTCTGTGG + Exonic
1018572466 6:165225544-165225566 CTTTTGGCTGTGTCCTCACATGG - Intergenic
1018781144 6:167066774-167066796 ATTTGGGCTGTGTCCACCTTTGG - Intergenic
1019132212 6:169885324-169885346 CTTTGTGCTGTGTCATCCCATGG + Intergenic
1019891870 7:3954020-3954042 CTTTGGCCTGTGTGCTCCTACGG - Intronic
1021064075 7:16150810-16150832 CTTTTTGCTGTGTCATCCTATGG + Intronic
1021861024 7:24906204-24906226 CATTGGCATGTGACCTCCCATGG + Intronic
1022031102 7:26492543-26492565 CATGGGTCCGTGTCCTCTTACGG + Intergenic
1022069913 7:26902835-26902857 CATTGGGCTGTTACCTCCCAAGG + Intronic
1023823968 7:43996358-43996380 TAGTGGGCTGTGTCCTTCTTTGG + Intergenic
1023961389 7:44929585-44929607 CATCTGGCTGTGTCCTCACATGG + Intergenic
1026103572 7:67402699-67402721 CTTTTTGCTGTGTCCTCCCATGG + Intergenic
1027328131 7:77064088-77064110 TAGTGGGCTGTGTCCTTCTTTGG - Intergenic
1028210213 7:88064613-88064635 CTTTGTGCTGTGTCCTCCAGGGG + Intronic
1029752236 7:102549762-102549784 TAGTGGGCTGTGTCCTTCTTTGG + Intronic
1029770188 7:102648856-102648878 TAGTGGGCTGTGTCCTTCTTTGG + Intronic
1030539097 7:110806893-110806915 CATTTGGCTATTTCATCCTAAGG - Intronic
1032186191 7:129728656-129728678 CATAGTGCTGTGTCCTCCTTTGG + Intronic
1033616824 7:143024336-143024358 CTTGGTGCTGTGTCATCCTATGG - Intergenic
1035372795 7:158390197-158390219 CCCTGGGCCGTGTCCTCCCACGG + Intronic
1035719063 8:1777754-1777776 CATGGGGCTGCTACCTCCTATGG + Intronic
1035905537 8:3506075-3506097 CCTGGGGCTGTGTTCTCATAAGG + Intronic
1035931519 8:3785451-3785473 CAATGGGCCATGCCCTCCTAAGG + Intronic
1037157090 8:15715500-15715522 CATCCTGCTGTGTCCTCCTTGGG - Intronic
1037213928 8:16425866-16425888 CATTGGGCTGTGGCTTCAGAGGG + Intronic
1037613394 8:20495479-20495501 CCTGGGGCTGTGACCTCCTGGGG + Intergenic
1039194894 8:35020107-35020129 CATTGGTCTGTCTTCTCCTCTGG - Intergenic
1040016874 8:42707150-42707172 AAGTGGGCTGTGTCCTCTGACGG - Intronic
1041570424 8:59332344-59332366 CATTGGGCTTTGTCTTTCTCTGG + Intergenic
1043196073 8:77293286-77293308 TATTTGGCTGTGTCCTGCCAGGG + Intergenic
1048205145 8:132409566-132409588 CACTGGACTGTGACCTCCTTGGG + Intronic
1049224096 8:141441456-141441478 CCCTGGCCTGTGACCTCCTAGGG - Intergenic
1052092218 9:24342635-24342657 CTTTTTGCTGTGTCCTCCGATGG - Intergenic
1052729521 9:32268949-32268971 CATGGAGCTGTCACCTCCTATGG - Intergenic
1053009691 9:34625952-34625974 CATTAGGCTCTCTCCGCCTAGGG + Intronic
1053819850 9:41955411-41955433 CAATGGTCTGTGTCCTTCTTTGG - Intronic
1054110116 9:61099070-61099092 CAATGGTCTGTGTCCTTCTTTGG - Intergenic
1054610741 9:67232055-67232077 CAATGGTCTGTGTCCTTCTTTGG + Intergenic
1059856927 9:118409648-118409670 CTTTGGGCTGCATCCTCCCACGG + Intergenic
1203465305 Un_GL000220v1:80436-80458 AATTGCTCTGTGTCCTCCGAAGG + Intergenic
1185480756 X:444601-444623 CATCAGGCTGTGTCCTCATATGG + Intergenic
1186402352 X:9271466-9271488 CATTGGGCGGTGTCAGGCTAGGG - Intergenic
1187609376 X:20924609-20924631 CATCTTGCTGTGTCCTCATATGG - Intergenic
1188815753 X:34711952-34711974 CATTGTACTTTGTGCTCCTAAGG - Intergenic
1189904477 X:45743521-45743543 CATGGGGCTGAGGCCCCCTATGG + Intergenic
1192629965 X:72769690-72769712 AAATGGGCTTTGTTCTCCTAGGG - Intergenic
1192651745 X:72951114-72951136 AAATGGGCTTTGTTCTCCTAGGG + Intergenic
1192968069 X:76201609-76201631 CATTGGGCTTTGTCTTTCTCTGG + Intergenic
1194579659 X:95656224-95656246 CTTTTGGCTGTGTCCTCACATGG - Intergenic
1194759261 X:97774942-97774964 CTTTGTGCTGTGTCATCCTATGG - Intergenic
1195539245 X:106043672-106043694 CATTTTGCTGTGTCCTCACATGG + Intergenic
1195706514 X:107741595-107741617 TATTGGACTGTATCTTCCTAAGG + Intronic
1200128522 X:153829413-153829435 CTGTGGGCTGAGACCTCCTAGGG - Intronic
1200145737 X:153925895-153925917 CTTTGGTCTCTGTCCTCCTTGGG - Intronic
1200771155 Y:7126462-7126484 CTTGGTGCTGTGTCCTCCCATGG - Intergenic