ID: 1017684135

View in Genome Browser
Species Human (GRCh38)
Location 6:156895019-156895041
Sequence CATGAACACCACCACACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017684135_1017684139 14 Left 1017684135 6:156895019-156895041 CCAGTGGTGTGGTGGTGTTCATG 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1017684139 6:156895056-156895078 AGAAATCTTGGATGTAAAGGTGG 0: 1
1: 0
2: 2
3: 20
4: 264
1017684135_1017684137 2 Left 1017684135 6:156895019-156895041 CCAGTGGTGTGGTGGTGTTCATG 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1017684137 6:156895044-156895066 CAAATGAGTTTGAGAAATCTTGG No data
1017684135_1017684138 11 Left 1017684135 6:156895019-156895041 CCAGTGGTGTGGTGGTGTTCATG 0: 1
1: 0
2: 2
3: 13
4: 140
Right 1017684138 6:156895053-156895075 TTGAGAAATCTTGGATGTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017684135 Original CRISPR CATGAACACCACCACACCAC TGG (reversed) Intronic
900160972 1:1223680-1223702 CGTGCACCCCACCACACCTCGGG + Intronic
900169677 1:1260647-1260669 CTTGAACATCCCCACACCCCAGG + Intronic
900816252 1:4848630-4848652 CATGAACACCTGCATCCCACTGG - Intergenic
900945541 1:5829417-5829439 CATTACCACCACCACACCCTCGG - Intergenic
906776159 1:48531493-48531515 CATGAACTCCCCATCACCACAGG - Intergenic
911373166 1:97018468-97018490 CAAGAAAATCACCAAACCACAGG + Intergenic
915249974 1:154580954-154580976 CCAGAACACCACAACGCCACAGG - Intergenic
916492574 1:165314938-165314960 CCTGAACACCAACACCCCAGAGG + Intronic
916717374 1:167456629-167456651 CATGTACACCACCACTCTTCGGG + Intronic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
922375547 1:224960942-224960964 CATGAACACCACCACGTCCGTGG - Intronic
1064280238 10:13944911-13944933 CATGAAGAGGGCCACACCACAGG - Intronic
1065263464 10:23950978-23951000 CATGAACACCCCAGCACCAGTGG - Intronic
1071934181 10:90508644-90508666 CATGAAAACCACCACAGCGTAGG + Intergenic
1075322570 10:121503896-121503918 CATGAACTCCAACACCCCGCTGG - Exonic
1075676175 10:124297124-124297146 CATCAACACCACCTCTCCATGGG + Intergenic
1079140454 11:17805844-17805866 CATGAGCCTCACCACAGCACTGG - Intronic
1079270676 11:18983016-18983038 AAAGAACACTACCAGACCACTGG + Intergenic
1080638647 11:34145250-34145272 CATGAACAACCACACAACACTGG - Intronic
1081837997 11:46173939-46173961 CATCAACTCCACCCCACCCCCGG + Intergenic
1084827902 11:71744918-71744940 CATTAAAATCACCACAGCACGGG - Intergenic
1084870317 11:72094312-72094334 CATGAAAACCAACAAACAACTGG + Intronic
1091754534 12:3042934-3042956 CATGGTCTGCACCACACCACAGG - Intergenic
1093708038 12:22296878-22296900 CATGAACACCTATACTCCACTGG + Intronic
1094059746 12:26301097-26301119 CATGAAAACAACAAAACCACTGG - Intergenic
1094557164 12:31512359-31512381 CGTACACACCACCACACCCCTGG + Intronic
1096256285 12:50064052-50064074 CATGAAGACCACCAGGCCTCTGG - Intronic
1099191536 12:79565874-79565896 CATCAAGACCACAAAACCACCGG + Intergenic
1101960732 12:109247789-109247811 TACAAACACCACCACCCCACTGG - Intronic
1104683093 12:130765686-130765708 CATTAACACCACCACATCATCGG - Intergenic
1105996327 13:25675738-25675760 CATGAACACCGGCACAACCCAGG - Intronic
1107443689 13:40450846-40450868 CATAATCACCACCACATCTCTGG + Intergenic
1112347182 13:98599959-98599981 CATTAACCCCTCCACATCACTGG + Intergenic
1113170421 13:107495607-107495629 TATGAAAACCTCAACACCACTGG - Intronic
1116114204 14:40627453-40627475 CATGAACAACCTTACACCACTGG - Intergenic
1120906910 14:89628583-89628605 CAGGAACACCATGCCACCACTGG - Intergenic
1120979514 14:90277962-90277984 CAGGACCACCACGACACCAGCGG + Exonic
1122070251 14:99201411-99201433 CATGATCATCACCATCCCACAGG + Intronic
1123121316 14:105918349-105918371 CCTGGACTCCACCAGACCACAGG - Intronic
1123404040 15:20010013-20010035 CCTGGACTCCACCAGACCACAGG - Intergenic
1123513379 15:21016659-21016681 CCTGGACTCCACCAGACCACAGG - Intergenic
1123807111 15:23886157-23886179 CAGGAAAACAACCACAACACTGG + Intergenic
1124721054 15:32110992-32111014 CATAACCAGCACCACCCCACAGG - Intronic
1125017275 15:34948951-34948973 AATTATCACCACCAAACCACCGG + Intronic
1126789944 15:52211853-52211875 CATGTTCACCACCACGCCACGGG + Exonic
1129546431 15:76400552-76400574 CCTGAACACCACCAGACCACAGG - Intronic
1131897201 15:97046690-97046712 CATGAACACAAACATATCACAGG + Intergenic
1133588780 16:7222177-7222199 CATAGACACGACCACACCAGAGG + Intronic
1136108308 16:28046956-28046978 CATGAGCACAAACACACAACTGG + Intronic
1137402012 16:48161338-48161360 CTTGCCCACAACCACACCACTGG - Intergenic
1138552240 16:57754222-57754244 CATGGACACCACCACACTGGGGG + Intronic
1139377162 16:66506988-66507010 GATGAACTCCACCATACCGCAGG - Intronic
1143369242 17:6428234-6428256 CATGGGCACCCCCACCCCACTGG - Intronic
1143736757 17:8916513-8916535 TTTCAACACCACCTCACCACTGG - Intronic
1144669675 17:17125903-17125925 CATGGTTACCACCACACCAGGGG - Intronic
1145233347 17:21190949-21190971 TATGGACACCACCACAGCCCAGG + Exonic
1147894359 17:43740927-43740949 CATGGAAACCACTAAACCACCGG - Intergenic
1148092405 17:45030478-45030500 AATGAGAACCACCACAGCACAGG + Intronic
1149163083 17:53718508-53718530 CTTGAAAACCAGCACAACACTGG - Intergenic
1150979205 17:70122736-70122758 GATGTACACCACCTCACCACTGG + Intronic
1151620801 17:75243735-75243757 GATGGACACAGCCACACCACAGG - Intronic
1159793823 18:72817352-72817374 CAAGAACACCAGCCCACCATGGG + Intronic
1164288079 19:23839888-23839910 CCTGAACACAACGACCCCACTGG - Intergenic
1164644450 19:29847990-29848012 GGTGCACACCACCACACCCCCGG - Intergenic
1165405796 19:35630347-35630369 CTTGAACACAACAACACAACAGG - Intronic
1167204435 19:48091052-48091074 GCTGAACTCCTCCACACCACGGG - Intronic
1167718655 19:51161864-51161886 AGTTAACACCACCAAACCACAGG - Intergenic
932290066 2:70569543-70569565 AATGAACATCACAACACAACTGG - Intergenic
933786146 2:85843721-85843743 CATGCACACCCCCACGCCCCTGG + Intronic
934544214 2:95201201-95201223 CATGACCACCACCACCCCCCTGG - Intergenic
934911788 2:98264724-98264746 CTTGAACACCACCAATCAACTGG - Intronic
935158671 2:100509009-100509031 CATCTACACCACCAGAACACTGG + Intergenic
940004480 2:148998528-148998550 CATGACCACCCCCACACCCCTGG - Intronic
940005230 2:149003852-149003874 TAAAAACACCACCACACCAAAGG - Intronic
940469183 2:154071866-154071888 CATAAACAGCACTTCACCACTGG - Intronic
940501482 2:154499858-154499880 AATGACCACCACCACAACAAGGG + Intergenic
945374196 2:209060025-209060047 TATGAACACTAGTACACCACAGG + Intergenic
945608274 2:211964278-211964300 CATCAACATCATCACAGCACTGG + Intronic
947378082 2:229517659-229517681 CATGAAAACCACCATCCCACGGG - Intronic
1169757825 20:9062339-9062361 CACCACCACCACCACACCACAGG - Intergenic
1170858869 20:20084099-20084121 CATGAACACCATCTCAACATGGG - Intronic
1170915213 20:20616674-20616696 CATGGACAGCACCACTCAACAGG + Intronic
1171413073 20:24959555-24959577 CATGAGGACCACCCCTCCACGGG + Intronic
1173203336 20:40970228-40970250 CATGAACACCAAAACACAAGCGG + Intergenic
1177217984 21:18153882-18153904 CCTGAACCCCATCCCACCACTGG - Intronic
949791510 3:7797221-7797243 CCTGATCAGCACCACAACACGGG - Intergenic
950894534 3:16436656-16436678 ATTGAACACCCCCCCACCACAGG + Intronic
950951690 3:17006679-17006701 CATGATGACCACCCAACCACGGG - Intronic
951599354 3:24356238-24356260 CTGGACCACCACCACACCAGTGG - Intronic
955487912 3:59453337-59453359 CATGACCACCATCACATCCCAGG + Intergenic
956058981 3:65330795-65330817 CATGAACTCCACTTCAGCACTGG - Intergenic
956371850 3:68571434-68571456 CATGAACACACAGACACCACTGG + Intergenic
961731790 3:128970795-128970817 CACAGCCACCACCACACCACAGG + Exonic
962280709 3:134049705-134049727 CATGCACACCACCTAACCATTGG + Intronic
968662564 4:1804847-1804869 CATGAGCTCCAACACACCACTGG + Exonic
969179095 4:5423782-5423804 CATCACCACCACCACCCCTCTGG - Intronic
969729413 4:8945076-8945098 CATTAAAGCCACCACAGCACGGG - Intergenic
970372266 4:15419905-15419927 TAAGAAAACCACCCCACCACTGG - Intronic
975906073 4:79214055-79214077 TATTTACACCACCACAACACAGG + Intergenic
978481852 4:109201351-109201373 AATGAAATCCACCACACAACAGG + Intronic
979173414 4:117630587-117630609 AATGAAAACCACCAAACCACAGG - Intergenic
980779570 4:137479248-137479270 CATGCACACCACCAAACAATGGG - Intergenic
981671411 4:147291780-147291802 TAGGAACACCACCACACCACAGG - Intergenic
983586994 4:169366227-169366249 CAGCAACAACACCAAACCACGGG + Intergenic
984591614 4:181623930-181623952 AAAGAACACCACCAAATCACAGG - Intergenic
985712397 5:1436810-1436832 CCTGAACACCAGTACACCCCAGG + Intronic
985782813 5:1879940-1879962 CATGACCACAACCCCACGACGGG - Intronic
990521060 5:56581623-56581645 CAAGAACTCAACCATACCACTGG - Intronic
990651744 5:57907963-57907985 CATGAACAGGTCCACACCCCAGG - Intergenic
991198424 5:63961671-63961693 CAACAACACCACATCACCACCGG - Exonic
995168479 5:109076894-109076916 CATGAAAATAACCACATCACAGG - Intronic
1002467371 5:179414310-179414332 CAGGCACATCTCCACACCACAGG + Intergenic
1002858889 6:1062206-1062228 CTTGAACAACACAACAACACAGG + Intergenic
1003796411 6:9610229-9610251 CATGAACACCTCCATGCCTCAGG - Intronic
1006253443 6:32810392-32810414 CTTGAAAACCACCACATGACAGG + Intergenic
1007341697 6:41194703-41194725 GGTGAACACCATCACACCAGTGG + Exonic
1008118357 6:47580045-47580067 CATCAACACAAGCACACAACAGG + Intronic
1008287951 6:49677145-49677167 CATGATTACCACTACACCAGTGG - Intergenic
1011946258 6:92907652-92907674 CATTAACTCCATCAGACCACTGG - Intergenic
1015312457 6:131780763-131780785 CATAAGCTCCACCACACTACTGG - Intergenic
1017387427 6:153901906-153901928 CATCACCACCACCACTCCATGGG - Intergenic
1017684135 6:156895019-156895041 CATGAACACCACCACACCACTGG - Intronic
1017727106 6:157283511-157283533 CATCATCAGAACCACACCACAGG + Intergenic
1020960795 7:14799542-14799564 CTTGAACTTCCCCACACCACTGG - Intronic
1021768977 7:23979284-23979306 CTTGATCCCCACCCCACCACTGG + Intergenic
1022950150 7:35330757-35330779 CATGAGCAAAACCACAGCACAGG - Intergenic
1023350245 7:39313229-39313251 CATCAACCCAACCACACCTCAGG + Intronic
1023367771 7:39481188-39481210 GATGCACACCACCACCCCAGGGG + Intronic
1024385645 7:48748608-48748630 CATCAACACTACCACATCACTGG + Intergenic
1026600220 7:71771475-71771497 CATCAACTTGACCACACCACAGG + Intergenic
1028891551 7:95993441-95993463 CATCAACACCACCACCACAGGGG - Intronic
1031838031 7:126702706-126702728 CAAGAACACCACCACAGAACTGG - Intronic
1035326744 7:158070715-158070737 CACGGGCACCTCCACACCACAGG - Intronic
1035339564 7:158151562-158151584 CACCACCACCACCCCACCACAGG - Intronic
1035449385 7:158965980-158966002 AATGAACAGCACCACAGCTCGGG - Intergenic
1039893205 8:41698130-41698152 CAAGAACACCAGAACATCACAGG + Intronic
1039955417 8:42203458-42203480 CATGATCAGCACCACAACTCAGG + Intronic
1040112139 8:43571279-43571301 CAGGAACTCCACGACACCACCGG + Intergenic
1041447931 8:57973943-57973965 CATGGACATCAACACACAACTGG + Intergenic
1045832064 8:106474232-106474254 CATGAACAGCAGCATACTACTGG + Intronic
1047124920 8:121949275-121949297 CATGGAGACCACCAACCCACCGG + Intergenic
1049290521 8:141799098-141799120 CATGGACGCCACCACACCTTGGG + Intergenic
1056507325 9:87269502-87269524 CAGCAGCACCACCACACCCCAGG + Intergenic
1057507909 9:95651144-95651166 CTTCAGCCCCACCACACCACAGG - Intergenic
1060481723 9:124020111-124020133 CTTGCACACTGCCACACCACCGG - Intronic
1062502304 9:136856799-136856821 CCTGACCACGACCACACCACAGG + Exonic
1186094577 X:6085761-6085783 CATGGAGTCCACCACACCAGGGG - Intronic
1186270256 X:7879024-7879046 CACCACCACCACCACTCCACTGG + Intergenic
1188203406 X:27321439-27321461 CATGCCCTCAACCACACCACTGG + Intergenic
1198002534 X:132453786-132453808 CATGAACACTTTCAGACCACTGG - Intronic
1198430061 X:136556484-136556506 CACTTACACCACCAAACCACTGG + Exonic
1199776530 X:151016481-151016503 TCTCAACACCACTACACCACTGG - Intergenic
1200125412 X:153811505-153811527 CATCCACACCAACACACCAGTGG + Intronic
1200369940 X:155714853-155714875 CACCAACACCACCAGTCCACGGG + Intergenic
1201531372 Y:14992539-14992561 CAGCAAGACCACCACCCCACTGG + Intergenic
1202018212 Y:20434644-20434666 CAGCACCCCCACCACACCACTGG + Intergenic