ID: 1017686098

View in Genome Browser
Species Human (GRCh38)
Location 6:156914753-156914775
Sequence GGGTGGCCAGAGGCCCGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017686098 Original CRISPR GGGTGGCCAGAGGCCCGCTT TGG (reversed) Intronic
901001929 1:6153148-6153170 GTGTGGCCAGAGGACGGCCTGGG - Intronic
901034850 1:6330325-6330347 GCCCGGCCAGAGGCCTGCTTAGG - Intronic
904382188 1:30119131-30119153 AGGTGGCCGGTGGCCCGCCTGGG + Intergenic
905547050 1:38808175-38808197 GGGTGACCAGAAGCCCTCTCTGG - Intergenic
907480720 1:54743929-54743951 GCAGGGCCAGAGGCTCGCTTGGG + Intergenic
911027118 1:93447936-93447958 GGGTGACCAGGTGCCCGCTTGGG + Intergenic
913521728 1:119650903-119650925 GAGTGGCCAGAGGAAGGCTTGGG + Intergenic
915172958 1:153990931-153990953 GGGTGGCCCGTGGGCCGCTGCGG - Intronic
917805211 1:178607036-178607058 GGGTGGCCAGGGGCCCAGTCAGG - Intergenic
920443643 1:205999168-205999190 GGGAGGCCAGCGGCGTGCTTAGG + Intronic
920560047 1:206932466-206932488 GGGTGGCCAGAGCCCGGCACAGG - Exonic
922156293 1:223042053-223042075 GGGTGGGGAGAGGCAGGCTTGGG + Intergenic
922717709 1:227885926-227885948 TGGTGGCCCGAGGCCAGCTGAGG + Intergenic
924517892 1:244781374-244781396 GGATGGCTTGAGGCCAGCTTGGG - Intergenic
1066509756 10:36083274-36083296 GGATGGCCAGAGGCCCTGGTTGG + Intergenic
1066638680 10:37533643-37533665 GGGTGGCTACAGGCCCTGTTAGG + Intergenic
1069694029 10:70373848-70373870 GGGTGGCCAGAGAACTGCTTGGG + Intronic
1069759323 10:70797918-70797940 GGGTGACCGGAGGCCCCCGTTGG + Intergenic
1069775852 10:70926687-70926709 GGGTAGCCAGAGGGCTGCCTGGG + Intergenic
1070421231 10:76239185-76239207 GGGTGGCCAGCTGCTTGCTTGGG + Intronic
1073288762 10:102403115-102403137 GGGTGGCCCGAGGCCGGCCCGGG + Exonic
1074857062 10:117481388-117481410 GGGTGGCCTGAGGACCGGCTAGG + Intergenic
1075893959 10:125978521-125978543 GGGTGGCTAGAGGCCCCAGTTGG + Intronic
1076809763 10:132880383-132880405 GGGTGGCCAAGGGCCTGCTGAGG + Intronic
1078551020 11:12280790-12280812 GTGTGCCCAGAGCCCAGCTTCGG - Intronic
1082006459 11:47422007-47422029 AGGTGGCCAGATTCCTGCTTTGG + Intronic
1087606547 11:100384443-100384465 GGGTGGCCAGAGGCCCTGGCTGG - Intergenic
1090807703 11:130212707-130212729 GAGAGGCCAGAGGCCTGCGTAGG + Intergenic
1092408333 12:8236005-8236027 TGGTGGCCAGAGGCCGGGTGTGG + Intergenic
1097732969 12:63150767-63150789 CGGTGGCCAGAGGCCACCATGGG + Exonic
1100613287 12:96210140-96210162 GGGGGGCCAGATGCCCACTGGGG + Intronic
1102203910 12:111077226-111077248 GGGCAGGCAGAGGCCAGCTTGGG - Intronic
1103159449 12:118716205-118716227 GGGTGGCCAGTAGACTGCTTTGG + Intergenic
1103379053 12:120479715-120479737 GGGAGGACAGAGGCAAGCTTGGG + Intronic
1103615157 12:122147182-122147204 GTTTGGCCAGAGGCCCCCTCCGG + Exonic
1103627103 12:122227563-122227585 GGGTTGCCAGCGCCCCGCCTGGG - Intronic
1103731010 12:123027834-123027856 GGGGAGCCAGAGGTCAGCTTGGG - Intronic
1103940781 12:124500189-124500211 GGATGTGCAGAGGCCTGCTTGGG - Intronic
1104124126 12:125829214-125829236 TGGTGTCCAGAGGCCAGTTTTGG + Intergenic
1110078833 13:71286100-71286122 TGGTGGCCAGAGGGTTGCTTGGG - Intergenic
1112333180 13:98492619-98492641 GGGTGGCCACAGGCTTCCTTAGG + Intronic
1114461114 14:22886744-22886766 CGGAGGCCAGAGGCCCGATCCGG + Exonic
1116320369 14:43454566-43454588 GGGTGGCTAGAGGCCTGGCTGGG - Intergenic
1117212464 14:53514843-53514865 GGGTGGCCTGAGGCTCGCTCTGG + Intergenic
1117829263 14:59733699-59733721 GGGTGGCCAGAGGCCCCAGCTGG - Intronic
1118596195 14:67437416-67437438 GGGTGGGCAGCGGCCAGATTAGG + Intergenic
1121075378 14:91063739-91063761 AGGTGGGCAGAGGCCCGGTCAGG + Intronic
1122270414 14:100566440-100566462 GGGTGCCCTGAGGCCAGCCTGGG - Intronic
1123838805 15:24225062-24225084 GGGTGACCAGAGGCCATATTTGG + Intergenic
1123848367 15:24327422-24327444 GGGTGACCAGAGGCCGTATTTGG + Intergenic
1123867425 15:24534945-24534967 GGGTGACCAGAGGCCGTATTTGG + Intergenic
1125491473 15:40151894-40151916 GGGTGGCCAGAGGACCTGATGGG + Intergenic
1128736409 15:70056331-70056353 GGGAGGCCTGTGGCCCGCATCGG + Exonic
1128758333 15:70198022-70198044 GGTTGGCCAGAGGCTGGCATGGG + Intergenic
1129333194 15:74838222-74838244 GGGTGGCCAGAGGCCCTGTGGGG + Intronic
1129696105 15:77741470-77741492 GGGTGGCCAGGGGCCTTCCTGGG - Intronic
1131057291 15:89383256-89383278 GTGTGGCCAGAGGCCTCCTGGGG - Intergenic
1132643607 16:988934-988956 GGGAGGACACAGGCCCTCTTGGG - Intergenic
1133257118 16:4523830-4523852 GGGTGGCCAGATGGCAGCCTGGG + Intronic
1133508302 16:6433456-6433478 GTGGGGCCAGAGGCCAGCCTAGG + Intronic
1134267591 16:12705221-12705243 GGATGGGCAGAGGCCCCCGTCGG - Intronic
1134623656 16:15708723-15708745 GGGTGGGCAGAGGGGCGCATTGG + Intronic
1136235469 16:28911038-28911060 AGGTAGCCAGAGGCCGGCTGGGG + Intronic
1138348108 16:56332249-56332271 GGGTGGCCAGAGTCCGGCTGGGG - Intronic
1139952756 16:70680073-70680095 GGGTGGGAAGGGGCCCGCTGGGG + Intronic
1140941283 16:79723644-79723666 GAGTGGCCAAAGGCCGCCTTTGG - Intergenic
1141248055 16:82329248-82329270 GGGTGGCCAGAGGCCAGCACTGG - Intergenic
1141651778 16:85396717-85396739 GGGAGGCCACAGGCCCCCGTGGG + Intergenic
1142146686 16:88495758-88495780 GAGTGGCCAGGAGCCCACTTGGG + Intronic
1142335913 16:89489876-89489898 GGGTGGCCGGGGGCCCGCGGCGG - Intronic
1143297221 17:5880408-5880430 GGGTGGCCAGACTCCCACTCCGG - Intronic
1143539852 17:7562337-7562359 CGGGGCCCAGAGGCCCGCATAGG + Intronic
1144788855 17:17846522-17846544 TGGTGGCCAGAGGACCTCTGAGG + Intronic
1146726304 17:35159164-35159186 GGGTGGCTGGAGGACCACTTGGG + Intronic
1147320539 17:39643252-39643274 GTGTGTCAAGAGGCCCTCTTTGG - Intronic
1147725970 17:42566409-42566431 GGCTAGCCAGAGGCGAGCTTTGG + Intergenic
1147951765 17:44111438-44111460 GGGTGGCCAGAGGCTGGGCTGGG + Intronic
1148688099 17:49512051-49512073 GGGTGAGCAGCGGCCCGCTGGGG + Exonic
1152023558 17:77794675-77794697 GGGTGTCCTGAGTCCCCCTTTGG + Intergenic
1152310970 17:79549586-79549608 GTGTCCCCAGAGCCCCGCTTTGG - Intergenic
1152657753 17:81527858-81527880 GTGTGGCCAGAGGCCGGTCTGGG + Intergenic
1154250119 18:12737397-12737419 GTTTGGCCAGAGGCCCCCTGCGG - Intergenic
1157595046 18:48859283-48859305 GGGTGGCCAGTGGGCCACTGTGG + Intronic
1157914502 18:51651648-51651670 CGGGGGCCAGACGCCCACTTTGG - Intergenic
1160369790 18:78362532-78362554 GGGAGGCAGGAGGCCTGCTTAGG - Intergenic
1160535014 18:79587013-79587035 GGGTGGCCAGCGGCCCCCTATGG + Intergenic
1160622215 18:80179437-80179459 TGGGGGCCAGTGGCCCGCTGAGG - Intronic
1163288481 19:16364010-16364032 TGGTGGCCAGAGGTCAGCTAAGG - Intronic
1163382559 19:16978505-16978527 TGCTGGCCAGAGTCCTGCTTTGG - Intronic
1163440956 19:17322367-17322389 GGGTAGACAGAGGCCGGCTCAGG - Exonic
1164778429 19:30872791-30872813 GGCTGGCCAGAGGCTGGTTTGGG + Intergenic
1167120950 19:47516069-47516091 GGGAGGCGAGAGGATCGCTTGGG + Intergenic
1167698213 19:51027172-51027194 GGGAGGCCAGGGGCCCACCTGGG - Intronic
1168354231 19:55691928-55691950 GGGTCCCCAGAGGCCGGCGTGGG - Exonic
1168667050 19:58211854-58211876 GGGTGGCCAGAAGCAGCCTTAGG + Intronic
926912537 2:17864439-17864461 GTGTGGGCAGAGGCCCACTGTGG + Intergenic
929493989 2:42423430-42423452 GGGTGGGCAGAGGTCAGATTAGG - Intronic
929922806 2:46184619-46184641 TGGTAGCTAGAGGCCTGCTTTGG + Intronic
932431320 2:71675412-71675434 GGGTGGCCTGGAGCCCTCTTGGG + Intronic
932570087 2:72934019-72934041 GAGTGGCCAGAGTCCAGCTTGGG - Exonic
934809380 2:97267202-97267224 GGGTGGCTGGAGGCCCGATTGGG - Intergenic
934809913 2:97269470-97269492 GGGTGGCCGGAGGCCCCGGTTGG - Intergenic
934809942 2:97269573-97269595 GGGTGGCCAGAGACCCCAGTTGG - Intergenic
934827750 2:97438366-97438388 GGGTGGCCAGAGACCCCAGTTGG + Intergenic
934827779 2:97438469-97438491 GGGTGGCCGGAGGCCCCGGTTGG + Intergenic
934828070 2:97489750-97489772 GGGTGGCTGGAGGCCCGATTGGG + Intergenic
934828265 2:97490558-97490580 GGGTGGCTGGAGGCCCGGTTGGG - Intergenic
937102790 2:119284422-119284444 GGGTTGCCAGAGACCTGCTGTGG - Intergenic
942459435 2:176159279-176159301 GCCTGGCCAGAGGCCCACTCGGG - Intronic
943612013 2:190045153-190045175 GGGTGGCTGGAGGCCCCTTTTGG + Intronic
944553165 2:200864199-200864221 GGCTGGGCGGAGGCCGGCTTCGG - Exonic
945435203 2:209809992-209810014 GGGTGGCCTGAGGGCTCCTTCGG - Intronic
947766816 2:232643242-232643264 GGGATGCCAGAGGCCAGCTTGGG - Intronic
948454405 2:238098100-238098122 GGGTGGGCAGAGCCCCACTAGGG + Intronic
1171215322 20:23348404-23348426 GGGTGGTCGGAGGCCCAATTAGG - Intergenic
1171969128 20:31552383-31552405 AGGTGGGCAGAGGCCAGATTTGG + Intronic
1172188721 20:33048888-33048910 GTGTAGCCAGAGGCCTGATTAGG + Intergenic
1172444128 20:34984428-34984450 GGGAGGCCAGAGGCCGGGCTGGG + Intronic
1173624289 20:44460426-44460448 GGGAGGTCAAAGGCCAGCTTGGG + Intronic
1173667891 20:44775584-44775606 GGGTGGCCCCAGCCCCGCTGTGG - Intronic
1176035710 20:63035509-63035531 GGGTGGCCTGAGGGCAGCTCCGG - Intergenic
1179249928 21:39664184-39664206 GGGAGGCCACAGGGCAGCTTAGG - Exonic
1179457295 21:41508225-41508247 GGGTGACCCGCGACCCGCTTGGG - Intronic
1180783807 22:18535970-18535992 CGGTGGGCAGAGGCCAGCCTAGG + Intergenic
1180983597 22:19891236-19891258 GGGTGGCCACAGGTCTGCCTGGG - Intronic
1182108312 22:27704814-27704836 GTGTGGCCAGAGTGACGCTTGGG + Intergenic
1182257362 22:29048841-29048863 GAGTGTGCAGAGGCCAGCTTGGG + Intronic
1184348217 22:43925795-43925817 GGGTGTCCACAGGCCACCTTGGG - Intronic
1184604641 22:45565301-45565323 GGGTGGGCAGAGGCCAGATCAGG - Intronic
1184777220 22:46629150-46629172 GGGTGAGCAGGGCCCCGCTTGGG + Intronic
952673593 3:36000313-36000335 GGGTGGCCAGAGGCCCCAGCTGG + Intergenic
954609730 3:51937929-51937951 GGGTGGCCAGAAGCTCTCATGGG - Intronic
954858459 3:53666798-53666820 GGGTGCCCAGTGGTCCCCTTTGG + Intronic
956860985 3:73323470-73323492 AGGTGGCCAGAGGTAAGCTTTGG - Intergenic
956995875 3:74825593-74825615 GGCTGGCCAGAGTCCCCCTCAGG - Intergenic
957872828 3:86110318-86110340 GGCTGGTCAGAGGCCCCATTTGG + Intergenic
960040006 3:113141095-113141117 GTGTGGCCAGAGGCCCTGTGCGG - Intergenic
960586376 3:119324044-119324066 GGATGGCAAGAGCCCCACTTAGG - Intronic
960997666 3:123350551-123350573 GGGTGGGCAGGGGGCCGCTGAGG + Intronic
962958940 3:140292149-140292171 GGGTGGCAAGAGGAGTGCTTGGG - Intronic
968550225 4:1218681-1218703 GGGCGGCCAGAGGCCCGCGGTGG - Intronic
968814983 4:2817615-2817637 GGGTGGCCAAAGGCCGGCAGAGG - Intronic
969603305 4:8189527-8189549 GGGTGGCCAGGGCCCCGCCAGGG + Intronic
973882835 4:55291116-55291138 GAGTGGTCAGAGGCCCGCTGTGG - Intergenic
975977531 4:80116039-80116061 GGGTGGCCAGAGGCCCTGGCTGG - Intronic
979967132 4:127088672-127088694 GGGTGGCCAGAGGCCCCAGCTGG - Intergenic
983898967 4:173113067-173113089 GGGTGGCTGGAGGCCCCATTTGG - Intergenic
984845386 4:184103861-184103883 GTGTGGCCAGGGGCTCGCTGGGG - Intronic
985345710 4:189002144-189002166 GGGTGGCCAGAGGCCCTGGCTGG + Intergenic
985896655 5:2752902-2752924 GGGCAGCCAGACGCCCTCTTCGG - Intronic
987906785 5:24088209-24088231 GAGTGGCCAGAGGCCTGGGTGGG - Intronic
991143460 5:63273805-63273827 GGTTGGCCAGAGGCCCCATTTGG + Intergenic
994075690 5:95646920-95646942 GCGGGGCCTGAGGCCCTCTTGGG + Exonic
997205100 5:132043561-132043583 AGGTGGCTGGAGGCCCGGTTGGG + Intergenic
997501918 5:134382024-134382046 GGGTGGCTTGAGGCCAGCCTAGG + Intronic
999277534 5:150341337-150341359 GGGTAGCCTAAGGCACGCTTAGG + Intergenic
1002051542 5:176574295-176574317 TGGTGGCCAGAGGACGGTTTGGG - Intronic
1002312672 5:178324124-178324146 GGGTGGGCTGAGGCCCTTTTGGG + Intronic
1006059555 6:31410283-31410305 GGGTGGCCACAAGCCCCCTAAGG - Intronic
1006072044 6:31505354-31505376 GGGTGGCCACAAGCCCCCTAAGG - Intronic
1007076959 6:39074256-39074278 GGGGGGCCAGAGGCCAGCCAAGG + Intronic
1007346070 6:41230076-41230098 GGATGGCCAGAGGTCCCCTCTGG - Exonic
1015919378 6:138251598-138251620 AGGTGGACAGAGGCCCGATCAGG - Intronic
1016423770 6:143912914-143912936 GGGTGACCAGAGGCCCCTGTGGG + Intronic
1017686098 6:156914753-156914775 GGGTGGCCAGAGGCCCGCTTTGG - Intronic
1018125604 6:160679388-160679410 GGGCGGCCACGGGCCCGCTGCGG + Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1019523741 7:1471678-1471700 GGGTGGGCAGAGGTCTGCCTGGG - Intronic
1021182461 7:17523672-17523694 GGGTGGCCACAGGACCATTTAGG + Intergenic
1026600962 7:71776907-71776929 GTGTGGCCAGAGGGCTCCTTTGG - Intergenic
1028187983 7:87811581-87811603 GGGAGGCCAAAGACCCACTTTGG - Intronic
1031627252 7:124005111-124005133 GGGTGGCTAGAGGCCCTGGTTGG + Intergenic
1031648777 7:124260004-124260026 GGCTGGCAAGAGGCCCACTTAGG - Intergenic
1033977159 7:147116497-147116519 GGGTGGCCAGAGGCCCCAGCTGG + Intronic
1034256206 7:149725942-149725964 GGGGGGCCAGGGGCCTGCTGGGG - Exonic
1034317232 7:150143853-150143875 GGGAGGCAAGAGGCCCCCTGTGG + Intergenic
1034349845 7:150408502-150408524 GGCTGGCCAGAGCCCCTCTCAGG + Intronic
1034364461 7:150534329-150534351 GGGTGGCTAGAGGCCCTGGTTGG + Intergenic
1034775520 7:153823364-153823386 GGGAGGCAAGAGGCCCCCTGTGG - Intergenic
1040316134 8:46261879-46261901 GGGTTGGCAGAGGCCTGCCTGGG - Intergenic
1043567447 8:81563023-81563045 GGGTGGCCACAGGGGTGCTTGGG + Intergenic
1048082985 8:131148926-131148948 GGGTGGCCAGAGGAGAGCCTGGG - Intergenic
1048239712 8:132729496-132729518 GAGTAGCCAGAGTCCTGCTTTGG + Intronic
1049109336 8:140634053-140634075 GGGTGGCCAGGCCCCCTCTTGGG - Intronic
1049253626 8:141602598-141602620 GGGCAGCCAGAGGGCAGCTTGGG + Intergenic
1049798630 8:144507660-144507682 GGGGGGCCAGAGACCACCTTTGG + Intergenic
1049825774 8:144666860-144666882 AGGTGGGCAGAGGCCTGTTTGGG - Intergenic
1049849039 8:144820985-144821007 GAGTGGCCACAGGCCTGCTGCGG - Intergenic
1053292207 9:36888688-36888710 GGCTGGGCAGAGGCACGCTATGG + Intronic
1053312682 9:37029420-37029442 GGGTCCCCAGAGTCCCGCCTGGG - Intronic
1053385733 9:37686271-37686293 GAGTGGCCAGAGGGCAGCATTGG + Intronic
1056505008 9:87250314-87250336 GGGTGCCTAGAGGTCCTCTTAGG + Intergenic
1059372574 9:113854627-113854649 GGGTGTCCTGAGACCAGCTTTGG + Intergenic
1060814652 9:126628196-126628218 GGGAGGCCAGAGGCCTGGCTGGG + Intronic
1061481160 9:130898344-130898366 GGGTGGCATGGTGCCCGCTTAGG + Intergenic
1062378385 9:136275215-136275237 GGGTGGCCAGTGCCCCGCCAGGG + Intergenic
1188901054 X:35733690-35733712 GGGTGGCCAGAGGCCCTGGCTGG + Intergenic
1190803409 X:53813453-53813475 GGGTGGCCAGAGGCCCCAGCTGG + Intergenic
1192891727 X:75398391-75398413 GGGTGGCCGGAGGCCCTGGTTGG - Intronic
1193715140 X:84928079-84928101 AGGTGGCTAGAGGCCCCATTTGG + Intergenic
1195370290 X:104166571-104166593 GGGTGGCCGGTGGGCCGCTGTGG + Intergenic
1195473606 X:105260343-105260365 GGGTGGCTGGAGGCCCAGTTTGG + Intronic
1196582008 X:117390865-117390887 GGGTGGCTAGAGGCCCCGGTTGG - Intergenic
1196932512 X:120695840-120695862 GGGTGGGCAGAGGCCCCATTGGG - Intergenic
1198385651 X:136126899-136126921 GGGAGGCCAGAGACCCACTGAGG - Intergenic
1199393976 X:147312455-147312477 GGGTGGCCGGAGGCTCTGTTTGG - Intergenic
1199794416 X:151180718-151180740 GGGTGGCCAGAGGCACGGTCGGG - Exonic
1201967616 Y:19755038-19755060 GGGTGGCTAGAGGCCCCAGTTGG + Intergenic