ID: 1017686571

View in Genome Browser
Species Human (GRCh38)
Location 6:156919549-156919571
Sequence GAAGCATCTCAGACACTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017686568_1017686571 -5 Left 1017686568 6:156919531-156919553 CCAGCTGTGTCCTGGTTTGAAGC 0: 1
1: 0
2: 3
3: 16
4: 182
Right 1017686571 6:156919549-156919571 GAAGCATCTCAGACACTGTTGGG No data
1017686563_1017686571 26 Left 1017686563 6:156919500-156919522 CCAGGAAGCCAGGCAGGCCTGGA 0: 1
1: 0
2: 9
3: 69
4: 550
Right 1017686571 6:156919549-156919571 GAAGCATCTCAGACACTGTTGGG No data
1017686566_1017686571 9 Left 1017686566 6:156919517-156919539 CCTGGAGTGTGTGGCCAGCTGTG 0: 1
1: 0
2: 2
3: 45
4: 707
Right 1017686571 6:156919549-156919571 GAAGCATCTCAGACACTGTTGGG No data
1017686564_1017686571 18 Left 1017686564 6:156919508-156919530 CCAGGCAGGCCTGGAGTGTGTGG 0: 1
1: 0
2: 6
3: 40
4: 416
Right 1017686571 6:156919549-156919571 GAAGCATCTCAGACACTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017686571 Original CRISPR GAAGCATCTCAGACACTGTT GGG Intronic
No off target data available for this crispr