ID: 1017690979

View in Genome Browser
Species Human (GRCh38)
Location 6:156964044-156964066
Sequence CACCCTTGGAAGCAGTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017690977_1017690979 14 Left 1017690977 6:156964007-156964029 CCACTGCTCGTTTGTTTCAGTTT 0: 1
1: 0
2: 0
3: 40
4: 897
Right 1017690979 6:156964044-156964066 CACCCTTGGAAGCAGTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017690979 Original CRISPR CACCCTTGGAAGCAGTCACA AGG Intronic
No off target data available for this crispr