ID: 1017693876

View in Genome Browser
Species Human (GRCh38)
Location 6:156994794-156994816
Sequence GACCAGTGGTCTCTGTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017693874_1017693876 -10 Left 1017693874 6:156994781-156994803 CCACCAGTGGACAGACCAGTGGT 0: 1
1: 0
2: 2
3: 5
4: 120
Right 1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 204
1017693869_1017693876 13 Left 1017693869 6:156994758-156994780 CCAGGGCTGCCTAGGATTGTCCT 0: 1
1: 0
2: 1
3: 20
4: 164
Right 1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 204
1017693872_1017693876 -7 Left 1017693872 6:156994778-156994800 CCTCCACCAGTGGACAGACCAGT 0: 1
1: 0
2: 1
3: 18
4: 125
Right 1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 204
1017693870_1017693876 4 Left 1017693870 6:156994767-156994789 CCTAGGATTGTCCTCCACCAGTG 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 204
1017693867_1017693876 18 Left 1017693867 6:156994753-156994775 CCAGCCCAGGGCTGCCTAGGATT 0: 1
1: 0
2: 3
3: 29
4: 257
Right 1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 204
1017693868_1017693876 14 Left 1017693868 6:156994757-156994779 CCCAGGGCTGCCTAGGATTGTCC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG 0: 1
1: 0
2: 0
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017693876 Original CRISPR GACCAGTGGTCTCTGTGTCC CGG Intronic
900103690 1:973376-973398 CACCACTGGTCTCTGTCTCTGGG + Intronic
901195659 1:7438543-7438565 CACCACTGGCCCCTGTGTCCAGG + Intronic
902717861 1:18284912-18284934 CAGCTGAGGTCTCTGTGTCCAGG - Intronic
902745215 1:18469356-18469378 GACCAGTGGCTTCTGAATCCAGG - Intergenic
902761111 1:18581327-18581349 GGCAGGGGGTCTCTGTGTCCAGG + Intergenic
903768131 1:25747706-25747728 CTCCAGAGGTCTCTGTCTCCAGG - Intronic
905835640 1:41117925-41117947 CACTACTGGTCTCTGTGTCTTGG + Intronic
907403879 1:54241900-54241922 GAACAGTGCTCTCTGAGCCCAGG + Intronic
907426589 1:54383488-54383510 GAGCTGTGGTCTCTGTGTGCAGG - Intronic
908818617 1:68058955-68058977 GACCAGTGGTCTCGGAGTCTGGG + Intergenic
909673098 1:78211193-78211215 CACCAGTCTTCCCTGTGTCCTGG - Intergenic
913314699 1:117540015-117540037 GTCCAGGGGTTTCTGTGGCCTGG - Intergenic
913510454 1:119556784-119556806 GTCCAGTGATCTCTGCTTCCTGG - Intergenic
915558659 1:156674197-156674219 GCACAGAGGTCTTTGTGTCCAGG + Intronic
916576859 1:166075019-166075041 TCCCAGTGTTCTCTGTTTCCTGG - Intronic
917489958 1:175489563-175489585 GCCCTGTGGTCTCTTTGCCCTGG + Intronic
917965863 1:180178152-180178174 GACCAGTTGTCTCCATGTGCTGG - Intronic
920161243 1:203999347-203999369 GACCAGTTGTCTGTGTCTTCAGG - Intergenic
921232144 1:213083741-213083763 CCCCAGTGGTCCCTGTCTCCTGG + Intronic
922229656 1:223674526-223674548 GGACAGTGCTCCCTGTGTCCTGG - Intergenic
1063585499 10:7348991-7349013 GACCTGGGATCTCTGTGACCAGG - Intronic
1066337627 10:34495210-34495232 GCACAGTGGTCACTGTGTTCTGG + Intronic
1066389167 10:34964996-34965018 GACCCGTGCTCTCAGTGCCCTGG - Intergenic
1068103166 10:52581487-52581509 GCCCAGTGGACTCTGTGTGGAGG + Intergenic
1069019106 10:63465814-63465836 GGCCCGAGGTCGCTGTGTCCGGG - Exonic
1070071745 10:73096725-73096747 GCCCAGTGGCCTCAGTCTCCGGG + Intronic
1070676427 10:78414909-78414931 GACCAGTTGTCCCTGTGTGCTGG + Intergenic
1071420732 10:85494708-85494730 CACCAGTGGTCTCTGTTACTTGG - Intergenic
1072764501 10:98084548-98084570 GCCCAGTGATGCCTGTGTCCTGG - Intergenic
1073512129 10:104049257-104049279 GACCAGTCATTTCTGTGTCTGGG - Intronic
1073881377 10:107984624-107984646 CACCTGTGGTCTCTAAGTCCGGG - Intergenic
1074199840 10:111224872-111224894 GCTCAGAGGTCTCAGTGTCCAGG - Intergenic
1074923927 10:118047195-118047217 GATCTGTGTTCGCTGTGTCCTGG + Intergenic
1076576618 10:131473976-131473998 GAGAAGTGGCCTCTCTGTCCAGG + Intergenic
1076707168 10:132308207-132308229 GAGCCGTGGTCCCCGTGTCCCGG - Intronic
1076728566 10:132425877-132425899 CAGCATTGGCCTCTGTGTCCTGG - Intergenic
1078145719 11:8720762-8720784 GACAAGTGGACCCTGAGTCCTGG + Intronic
1081671761 11:44946452-44946474 CACCACTGGGCTCAGTGTCCAGG + Intronic
1084349507 11:68585372-68585394 GACCAGTAGTTTCTGTTGCCTGG + Intronic
1085279523 11:75320827-75320849 GCCCAGTGGTCTGGGAGTCCAGG - Intronic
1086951117 11:92890909-92890931 GGCCTGTGGGCTCTGTGCCCTGG - Exonic
1091012849 11:132022098-132022120 GACCAGTGGCATCTCTGCCCTGG - Intronic
1091780179 12:3208596-3208618 GCCCTGTGTGCTCTGTGTCCTGG - Intronic
1096524758 12:52203840-52203862 GAGCAGGGCTCTCTGTGCCCAGG + Intergenic
1097947665 12:65389717-65389739 TGCCAGTGCTCTCTGGGTCCTGG + Intronic
1099473602 12:83080703-83080725 GTCCAGTGATCTCAGTGCCCTGG - Intronic
1102600382 12:114025292-114025314 CCCCAGTGGTCCCTGTTTCCTGG + Intergenic
1104094848 12:125547778-125547800 GGCCAGTGGTCCCTGGCTCCAGG + Intronic
1104100178 12:125600199-125600221 GTCCAGTGTTTTCTGTGTCTTGG - Intronic
1110730798 13:78876876-78876898 TACCAGTGGTGTCTGTGACAGGG - Intergenic
1112100076 13:96178800-96178822 GGGCAGTGGTGTCTGTGCCCAGG - Intronic
1112153594 13:96792627-96792649 GACCAGAGGCCTCTCTGTCCAGG - Intronic
1113923391 13:113927225-113927247 GACCAGAGCTCCCTGAGTCCAGG - Intergenic
1114902679 14:27084452-27084474 GACCAGTGTTCTGCATGTCCAGG - Intergenic
1115821333 14:37215300-37215322 CACTACTGGTCTCTGTGTCTTGG + Intronic
1116963455 14:50990648-50990670 ATCCAGTGCCCTCTGTGTCCTGG + Intronic
1122723637 14:103736202-103736224 GACCATTGCTCTCTGGCTCCAGG - Exonic
1202902057 14_GL000194v1_random:49795-49817 GACCAGGGCTCTTTCTGTCCAGG - Intergenic
1202891122 14_KI270722v1_random:158977-158999 CACTACTGGTCTCTGTGTCTAGG + Intergenic
1125505635 15:40266119-40266141 GACCCGTGGGCTCTGTGGCTCGG - Exonic
1127901860 15:63346709-63346731 GAGCATGGATCTCTGTGTCCAGG - Exonic
1128063791 15:64751638-64751660 GATCACTGGTCTCTGTCTCCAGG - Exonic
1128110332 15:65072059-65072081 GACCAGTGGGCTCTCAGTGCTGG - Intronic
1131422320 15:92317424-92317446 TTCCATTGGTCTCTGTGCCCAGG + Intergenic
1132339577 15:101069383-101069405 GATCAGATGTCTCTGTGTTCGGG + Exonic
1136710331 16:32231750-32231772 CACTAGTGGTCTCTGCGTCTTGG - Intergenic
1136757579 16:32697661-32697683 CACTAGTGGTCTCTGCGTCTTGG + Intergenic
1136810527 16:33172714-33172736 CACTAGTGGTCTCTGCGTCTTGG - Intergenic
1136817003 16:33282794-33282816 CACTAGTGGTCTCTGCGTCTTGG - Intronic
1137411804 16:48234901-48234923 GAGCAGAGGTCACTGTGCCCAGG + Intronic
1140408275 16:74725337-74725359 GCCCTGTGGTCTGTCTGTCCTGG - Intronic
1142132040 16:88435598-88435620 GACCAGGAGGCTCTGTGTGCAGG + Exonic
1203059729 16_KI270728v1_random:958010-958032 CACTAGTGGTCTCTGCGTCTTGG + Intergenic
1143658468 17:8311028-8311050 GCTCAGTGGCCTCTGTGTTCTGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1145970998 17:28956492-28956514 GAGCAGAGGTCTCTGTCACCTGG + Intronic
1146644394 17:34567470-34567492 GGGCAGTGTTCTCTGTGTCATGG + Intergenic
1147019742 17:37521712-37521734 GACCATCGGTATCTGTCTCCAGG - Intronic
1147210567 17:38870483-38870505 GAGGGGTGGGCTCTGTGTCCCGG + Intronic
1149417067 17:56470534-56470556 TACCAGAGGTCTCTGTGGACTGG - Intronic
1150634826 17:66905584-66905606 GACCAGTGGGGTCTGTGGTCAGG + Intergenic
1152210950 17:79002976-79002998 AACCAGAGGTGTCTGAGTCCCGG + Intronic
1152298315 17:79481188-79481210 GGCCTCTGGTCTCTTTGTCCAGG + Intronic
1152941460 17:83174865-83174887 GCCCAGTGGTCAGTGTGACCAGG - Intergenic
1156414501 18:36873569-36873591 AACCAGTGATCCCTGTTTCCTGG - Intronic
1160971564 19:1769985-1770007 GGCCAGTGGACTCTGTTTTCTGG + Intronic
1160986379 19:1840872-1840894 GTCCTGTGGTGTGTGTGTCCAGG + Intronic
1161723112 19:5914518-5914540 GAACAGTGGTCTCAGGGGCCGGG - Intronic
1162397391 19:10424867-10424889 GTCCCATGGTCTCTGTTTCCCGG - Intronic
1162786019 19:13035390-13035412 GCATAGTGGTCTCTGTGTGCTGG + Intronic
1163233410 19:16018335-16018357 GACAACAGGCCTCTGTGTCCAGG + Intergenic
1163371767 19:16904840-16904862 GACTAGTGATGTCTGTGTCCAGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163860557 19:19740635-19740657 GACAATGGGCCTCTGTGTCCAGG + Intergenic
1164531201 19:29049558-29049580 GACCAGAGTGCTCTGAGTCCTGG + Intergenic
1164652015 19:29897600-29897622 GGTCAGTGGTCCCTGTGGCCAGG - Intergenic
1164842982 19:31408206-31408228 ACCCAGTGATCTCTGTCTCCTGG + Intergenic
1164876905 19:31697500-31697522 GACCAGTGATATTTGTGTCTGGG - Intergenic
1165178738 19:33949301-33949323 CAGGAATGGTCTCTGTGTCCTGG + Intergenic
1165228975 19:34374368-34374390 GACCAGTGGTCCTTGTCTCCTGG - Intronic
1167337850 19:48897585-48897607 GACCTGGGATCTCTGGGTCCCGG - Intronic
1202666543 1_KI270708v1_random:125815-125837 CACTACTGGTCTCTGTGTCTAGG + Intergenic
925380371 2:3420755-3420777 GTCCTGAGTTCTCTGTGTCCCGG + Intronic
925907990 2:8550912-8550934 GGACAGTGGTGTCTGTGACCTGG - Intergenic
926851591 2:17204123-17204145 CCCCAGTGATCTCTGTGCCCTGG + Intergenic
927503289 2:23596378-23596400 GAGCAGAGGTCTTGGTGTCCTGG + Intronic
933725657 2:85425735-85425757 AAACAGTGGTATCAGTGTCCAGG - Intronic
937154365 2:119708181-119708203 CTCCAGTGGTCTTTGTCTCCTGG + Intergenic
938063729 2:128270188-128270210 GCCCAGTGTTTTCTGTGGCCTGG + Intronic
938105760 2:128528789-128528811 GAGCATTGTTCTCCGTGTCCGGG + Intergenic
938593308 2:132761373-132761395 GACCAGTGGTCCCAGTGTGCTGG - Intronic
939764584 2:146230750-146230772 GAACAGGGCTGTCTGTGTCCAGG + Intergenic
945177300 2:207055385-207055407 TACCAGTGTCCTCTGTGTCCTGG - Intergenic
946397496 2:219450504-219450526 GACCAGTGGTCCCTGCTTACAGG - Intronic
947357841 2:229315730-229315752 GACCACTGGCCTTTCTGTCCTGG - Intergenic
947582974 2:231333088-231333110 GACCAGGGGGCCCAGTGTCCTGG - Intronic
947596997 2:231419260-231419282 GATCAGTGGTCTCCCTGTCAGGG + Intergenic
947606545 2:231489673-231489695 CACCACTGGTCTCCGTGTCTTGG - Intergenic
947837995 2:233189107-233189129 GGCCAGTGGGGGCTGTGTCCGGG - Intronic
948779543 2:240310322-240310344 GACGAGAGGTCTCTGAGACCCGG - Intergenic
948847027 2:240688040-240688062 GCCCAGGGGTCTCTTTGTCCAGG + Intergenic
1169359021 20:4932187-4932209 GCCCAGTGCTTACTGTGTCCTGG - Intronic
1172238720 20:33396993-33397015 GACCATTGGCCTCTGTGTCTTGG - Exonic
1172293376 20:33791520-33791542 GACCTGAGGTGTCTGTTTCCTGG + Exonic
1172941377 20:38656867-38656889 GACTGGTGCTCCCTGTGTCCTGG - Intergenic
1174082835 20:47983180-47983202 GGCCTGTGGTCACTGTCTCCAGG + Intergenic
1174133120 20:48359802-48359824 GGCCTGTGGTCACTGTCTCCAGG - Intergenic
1174253092 20:49233973-49233995 GACCACTGTTCTCTGTCGCCTGG + Intronic
1174407808 20:50313368-50313390 GCCCAGAGGCCTCTGTCTCCAGG + Intergenic
1175943768 20:62549617-62549639 GGCCTCTGGTCTCTGCGTCCAGG + Intergenic
1176049240 20:63107928-63107950 GGGCAGTGGTCTCCATGTCCTGG - Intergenic
1176621426 21:9064562-9064584 GACCAGGGCTCTTTCTGTCCAGG - Intergenic
1177147279 21:17420364-17420386 GACCCTTGGTTTCTGTCTCCAGG + Intergenic
1180847329 22:18991057-18991079 GGACAGTGGTCTCTGTCTCTGGG - Intergenic
1182056334 22:27358224-27358246 GACCAGCAGTCTCTGTCACCTGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1184379110 22:44134099-44134121 GTCCCGTGGTCTCTGTGGTCGGG + Intronic
1185360643 22:50404763-50404785 GACCTGTCCTCTCTGTGTCTGGG - Intronic
949792893 3:7812508-7812530 GAGCATCAGTCTCTGTGTCCTGG - Intergenic
950214218 3:11146787-11146809 TACCAGAATTCTCTGTGTCCTGG + Intronic
950481649 3:13247919-13247941 TTCCAGTGGGCTCTTTGTCCAGG + Intergenic
950660353 3:14463437-14463459 GACCAGAGGGCTTTGTGTCAGGG - Intronic
951360081 3:21714559-21714581 GAAGAGTGGTGTCTGTGTTCAGG - Intronic
951463565 3:22977310-22977332 GAACAATGGTCTCTGGGACCGGG + Intergenic
952412285 3:33060266-33060288 GACCAGTGAAGTCTCTGTCCTGG - Intronic
956474552 3:69606529-69606551 CCCCAGTGGTCTTTGTGTCTGGG + Intergenic
956825864 3:72996686-72996708 GCCCAGTGGCGTCTGCGTCCCGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959560609 3:107776099-107776121 GACCAGTGCTCTCTGTAGTCTGG + Intronic
960194215 3:114745465-114745487 GACTAGTGGTCTCTTTATCCTGG - Intronic
963487719 3:145957213-145957235 GACCAGTGGTCTAAGAGTGCAGG - Intergenic
964514772 3:157495942-157495964 AAGCACTGGTTTCTGTGTCCAGG - Intronic
968728212 4:2258058-2258080 GAGCACTGCTCTCTGTGCCCTGG - Intronic
973590705 4:52437652-52437674 GAGCAGTGGTTCCTGTCTCCTGG - Intergenic
973896220 4:55416062-55416084 GACCAGTGGTCTCAAGCTCCTGG + Intronic
977797100 4:101179410-101179432 GACCAGTGGTGGTGGTGTCCAGG - Intronic
986372987 5:7099143-7099165 GTCCGGTGGCCTCTGTGTCATGG - Intergenic
986418838 5:7556604-7556626 GACCAGGGGTCCCTGTCCCCAGG + Intronic
990304822 5:54483430-54483452 GACCAGTGGTCTCTTTAGCTAGG - Intergenic
990333189 5:54747462-54747484 CACCAGTGGCCTCTGTGCCATGG + Intergenic
990796489 5:59547827-59547849 GACCAGGCCTCTGTGTGTCCCGG - Intronic
991359115 5:65802112-65802134 GACCAGTGGTACCTTTGCCCAGG + Intronic
999146288 5:149397794-149397816 CACCAGTGGCCCCTGGGTCCTGG - Intronic
999311958 5:150557375-150557397 GACCCGTGGTCTGTGTGCACTGG + Exonic
999328923 5:150659911-150659933 GACCACCGGTGTCTGTGTGCTGG - Intergenic
999371363 5:151057139-151057161 CACCAGTGGCCTGTGAGTCCTGG - Intronic
999525490 5:152401749-152401771 GCTCAGTGGTGGCTGTGTCCTGG + Intronic
1000910713 5:167018775-167018797 GATCAGAGGTCTCTGTCACCTGG - Intergenic
1001494096 5:172175674-172175696 GCCTTGTGGTCTCTGTGCCCAGG - Intronic
1002174059 5:177391462-177391484 GCCCAGTGGTCTCTGTGGGGAGG - Intronic
1002205831 5:177561989-177562011 CACTACTGGTCTCTGTGTCTTGG + Intergenic
1002648443 5:180673954-180673976 GAACAGTGGCCGCGGTGTCCCGG - Intergenic
1004290677 6:14364082-14364104 TACCTGTGGTGTCTGTGTCGGGG + Intergenic
1006037557 6:31225404-31225426 GACCCCTGGCCACTGTGTCCTGG + Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1007549986 6:42721890-42721912 TGCCAGGGGTGTCTGTGTCCCGG + Exonic
1008045412 6:46847170-46847192 GAACATTGGTCTTTATGTCCTGG + Intergenic
1008200639 6:48584328-48584350 GCCCAGTGATCTCTGCCTCCTGG - Intergenic
1008233804 6:49018958-49018980 GATCAGTGGTTTCTGTGTAAAGG - Intergenic
1014713935 6:124842096-124842118 GACCTGAGGACTCTGTGTTCAGG + Intergenic
1017693876 6:156994794-156994816 GACCAGTGGTCTCTGTGTCCCGG + Intronic
1019437514 7:1029686-1029708 GACCAGAGCTCAGTGTGTCCTGG - Intronic
1019542812 7:1559210-1559232 GACCATTGTTCACTGCGTCCAGG + Intronic
1020003870 7:4771601-4771623 GCTCAGGGGTCTGTGTGTCCGGG - Intronic
1020003919 7:4771745-4771767 GGTCAGGGGTCTGTGTGTCCAGG - Intronic
1020003926 7:4771768-4771790 GCTCAGGGGTCTGTGTGTCCAGG - Intronic
1020003949 7:4771840-4771862 GGTCAGGGGTCTGTGTGTCCAGG - Intronic
1020003956 7:4771863-4771885 GCTCAGGGGTCTGTGTGTCCAGG - Intronic
1021029841 7:15717935-15717957 GACAAGTGGTCTGGGTGGCCAGG - Intergenic
1021583180 7:22178468-22178490 GACCAGTGGGCTCTATATCAGGG + Intronic
1022483992 7:30763771-30763793 GGGCAGTGGTCTCTTTCTCCAGG - Intronic
1026982536 7:74535260-74535282 GGGCTGTGGTTTCTGTGTCCTGG + Intronic
1030010856 7:105165568-105165590 GACCAGTGGTCTGTGTCTAAAGG + Intronic
1031076600 7:117219437-117219459 AACCAGGGGTCTCTGTGCTCAGG - Intronic
1033574090 7:142663199-142663221 CACTACTGGTCTCTGTGTCTTGG + Intergenic
1034662189 7:152781224-152781246 GAGCAGTGGTCTATGTGTAATGG - Intronic
1036973434 8:13381400-13381422 CTCCAGTGATCTGTGTGTCCTGG + Intronic
1041428542 8:57751172-57751194 GAACACTGGTCTCTGTGCTCTGG + Intergenic
1041847628 8:62349626-62349648 GACTAGTGTTCTGTGTGTGCTGG - Intronic
1047536555 8:125725373-125725395 GACCTTTTGTCTCTGTGGCCAGG - Intergenic
1048959147 8:139561580-139561602 GCCCAGTGGTCTCTGGGCACTGG - Intergenic
1049438137 8:142597110-142597132 GTCCAGTGGTGCCTGGGTCCTGG - Intergenic
1049521417 8:143093223-143093245 GCCCACTGGTGCCTGTGTCCCGG - Intergenic
1049794438 8:144490119-144490141 CACACGTGGGCTCTGTGTCCCGG - Exonic
1052420711 9:28240438-28240460 TTCCATTGGTCTATGTGTCCGGG - Intronic
1056718269 9:89051901-89051923 GACCAGGTGTCTCTGAGCCCAGG + Intronic
1057290383 9:93802572-93802594 GAAGAGTGGTCCCTGTGTCCAGG + Intergenic
1060223422 9:121776142-121776164 AAGCTGTGCTCTCTGTGTCCTGG + Intronic
1062264573 9:135681165-135681187 GACCAGTGTGCTCTGTGGGCAGG + Intergenic
1062392038 9:136337733-136337755 GGCCAGAGATCTGTGTGTCCGGG - Intronic
1203744609 Un_GL000218v1:34974-34996 GACCAGGGCTCTTTCTGTCCAGG - Intergenic
1203488251 Un_GL000224v1:78201-78223 CACTACTGGTCTCTGTGTCTAGG + Intergenic
1203500872 Un_KI270741v1:20097-20119 CACTACTGGTCTCTGTGTCTAGG + Intergenic
1203565495 Un_KI270744v1:84510-84532 GACCAGGGCTCTTTCTGTCCAGG + Intergenic
1185669504 X:1794912-1794934 GACCCGGAGTCTCTGTGGCCAGG - Intergenic
1193959979 X:87913951-87913973 TACCAGTGGTCTCTGTCTCTTGG - Intergenic
1201157955 Y:11150015-11150037 GACCAGGGCTCTTTCTGTCCAGG - Intergenic
1201761428 Y:17543480-17543502 GATCAGTGGTCTCAGAGTCTTGG + Intergenic
1201840124 Y:18362510-18362532 GATCAGTGGTCTCAGAGTCTTGG - Intergenic