ID: 1017701290

View in Genome Browser
Species Human (GRCh38)
Location 6:157074835-157074857
Sequence GGTGAGGTATAGTAACATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017701282_1017701290 30 Left 1017701282 6:157074782-157074804 CCTACTCTAGGGTCTGGGAACGT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1017701290 6:157074835-157074857 GGTGAGGTATAGTAACATCATGG No data
1017701287_1017701290 4 Left 1017701287 6:157074808-157074830 CCAGGGAACAGGGTAATTATTTA 0: 1
1: 0
2: 1
3: 19
4: 135
Right 1017701290 6:157074835-157074857 GGTGAGGTATAGTAACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017701290 Original CRISPR GGTGAGGTATAGTAACATCA TGG Intronic
No off target data available for this crispr