ID: 1017702893

View in Genome Browser
Species Human (GRCh38)
Location 6:157093067-157093089
Sequence CAGCGAAGGGAGAAGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 537}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017702893_1017702901 2 Left 1017702893 6:157093067-157093089 CCCGCTGCCTTCTCCCTTCGCTG 0: 1
1: 0
2: 2
3: 44
4: 537
Right 1017702901 6:157093092-157093114 AATGAAGATTCAGAATGGAGGGG 0: 1
1: 0
2: 4
3: 49
4: 405
1017702893_1017702899 0 Left 1017702893 6:157093067-157093089 CCCGCTGCCTTCTCCCTTCGCTG 0: 1
1: 0
2: 2
3: 44
4: 537
Right 1017702899 6:157093090-157093112 AGAATGAAGATTCAGAATGGAGG No data
1017702893_1017702900 1 Left 1017702893 6:157093067-157093089 CCCGCTGCCTTCTCCCTTCGCTG 0: 1
1: 0
2: 2
3: 44
4: 537
Right 1017702900 6:157093091-157093113 GAATGAAGATTCAGAATGGAGGG No data
1017702893_1017702898 -3 Left 1017702893 6:157093067-157093089 CCCGCTGCCTTCTCCCTTCGCTG 0: 1
1: 0
2: 2
3: 44
4: 537
Right 1017702898 6:157093087-157093109 CTGAGAATGAAGATTCAGAATGG 0: 1
1: 0
2: 8
3: 50
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017702893 Original CRISPR CAGCGAAGGGAGAAGGCAGC GGG (reversed) Intronic
900592225 1:3465254-3465276 CAGCGCAGGGAGAATGCCGAGGG + Intronic
900844241 1:5083431-5083453 CAGCCAAGGGAAGAGGCACCTGG - Intergenic
900969613 1:5983577-5983599 CAGCAAAGGGAGGAGGCATATGG - Intronic
901823863 1:11847881-11847903 CTGCCAAGTGAGAAGCCAGCAGG + Intronic
901974357 1:12932518-12932540 CAGAGGAGAGAGATGGCAGCAGG - Intronic
902010817 1:13269250-13269272 CAGAGGAGAGAGATGGCAGCAGG + Intergenic
902219884 1:14958097-14958119 CAGGGGAGGGAGCAGGCAGAGGG - Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902970976 1:20049653-20049675 GAGCAAAGGGACATGGCAGCAGG - Intronic
903588776 1:24438459-24438481 CAGGGACGGGAGAGGGCAGGAGG - Intronic
904010944 1:27390280-27390302 CTGCGATGGGTGAAGGCTGCTGG - Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904678928 1:32215466-32215488 CACCGAAGGAAGGAGACAGCGGG + Exonic
905312010 1:37055866-37055888 CAGGGAAGAGAGCAGCCAGCAGG - Intergenic
905665578 1:39761274-39761296 CAGGGAAGGGAGGAGGCAAGAGG - Intronic
905876378 1:41434383-41434405 CAGTCAAGGAAGGAGGCAGCAGG - Intergenic
906263922 1:44414062-44414084 CACTTAAGGGAGAAGGCTGCTGG + Intronic
907158959 1:52357697-52357719 CACTGAAGGGAGAAGGCCACTGG + Exonic
908247890 1:62242401-62242423 AAGAGAAGGGTGCAGGCAGCTGG + Intronic
908512647 1:64861657-64861679 CAGTGAAGGGAAAAAGGAGCAGG + Intronic
909433503 1:75615824-75615846 CGGCGAGGGGAGGAGGGAGCGGG + Intergenic
910720234 1:90278317-90278339 GAGAGAAGGGAGAATGCAGATGG - Intergenic
911191167 1:94949915-94949937 CAGCAAAGAGAAAAGGCATCTGG + Intergenic
911662947 1:100523945-100523967 CAGCAAAGGGAAAAGGCACATGG + Intergenic
912948816 1:114106582-114106604 CAGAGAAGGGAGAGAGCAGCAGG - Intronic
913141193 1:115942933-115942955 CAGCCAAGGGAGGAGGGTGCTGG - Intergenic
914017672 1:143835515-143835537 GAGAGAAGGGAGAAGGCAAGGGG - Intergenic
914656282 1:149744050-149744072 GAGAGAAGGGAGAAGGCAAGGGG - Intergenic
914758549 1:150580267-150580289 CAGAGATGGGAGAAGCAAGCAGG - Intergenic
914796758 1:150926408-150926430 AAGCGAAGGGATAAGGGAGGAGG - Exonic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
916014156 1:160733737-160733759 GAGAGAGGGGAGAAGGCACCAGG + Intergenic
916119389 1:161513959-161513981 GAGAGAAGGGACAAGGCAGGAGG - Intronic
916146284 1:161743128-161743150 CAGCGAAGGGAAAAGGCCCAGGG + Intergenic
916488248 1:165278547-165278569 GAGAGAAGAGAGAATGCAGCAGG - Intronic
916647182 1:166797512-166797534 CAGCGAGGGGAGCCGGCAGCAGG + Intergenic
917637800 1:176954093-176954115 CAGCCATGGGAGATGGCAGTGGG - Intronic
918005003 1:180533727-180533749 CACCTAAGAGAGAAGGCAGGCGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
921432669 1:215082543-215082565 CTGAGAGGGGAGGAGGCAGCAGG + Intronic
921558389 1:216626792-216626814 TGGCCAAGGGATAAGGCAGCGGG - Intronic
921650396 1:217671602-217671624 CAGGGAGGGGAGAAGACAGAAGG - Intronic
921756666 1:218864676-218864698 AAGGGAAGGGGGAAGGTAGCAGG - Intergenic
922503334 1:226112087-226112109 CAGCCAAAAGTGAAGGCAGCTGG - Intergenic
922740473 1:228011411-228011433 GGGCGAAGGGAGAAGGAAGAAGG - Intronic
922866286 1:228863944-228863966 CAGCGCAGGGAGCAGGCTCCTGG - Intergenic
922984988 1:229859420-229859442 CAGCAAACAGAAAAGGCAGCAGG - Intergenic
923070778 1:230562593-230562615 CAGCAAAGGGAAAAGGCACAGGG - Intergenic
923482356 1:234397264-234397286 GAGGGAAGGGAGAAGGGAGTAGG + Intronic
924740176 1:246790248-246790270 CAGGGAGGGGAGAGGGCTGCTGG + Intergenic
1062931288 10:1354448-1354470 CAGCGAAGGGAGATGGGGGTGGG - Intronic
1062931360 10:1354761-1354783 CAGCTAAAGGAGATGGCAACTGG - Intronic
1063124058 10:3124583-3124605 CAGGGAAGGGGGCATGCAGCTGG - Intronic
1064887334 10:20124635-20124657 CAGCGAAGGGAGATGGGGGTGGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066472339 10:35711324-35711346 CAGCGAAGGAAGAAGTCTCCGGG - Intergenic
1066671434 10:37844592-37844614 CAACGTAGGGAGAAGGCAGCTGG + Intronic
1067018253 10:42773380-42773402 CAGGGATGGGAGAAGACAGAAGG - Intergenic
1067167988 10:43880345-43880367 CATGGAAGGGAGAAGGGACCAGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067523274 10:47023523-47023545 CAGGCAAGGGAGCAGGCAGGAGG + Intergenic
1067842216 10:49690097-49690119 CAGCAAAAAGCGAAGGCAGCAGG + Intronic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1069991544 10:72319629-72319651 CAGCCGGGGCAGAAGGCAGCCGG + Intergenic
1070560354 10:77561773-77561795 CAGAGAAGGGATAAGGTAACAGG + Intronic
1071405925 10:85332414-85332436 CAGAAAAGGAAGAAGGCAGAGGG - Intergenic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1073061774 10:100737647-100737669 AGGCAAAGGGAGAAGGCGGCTGG - Intronic
1073633017 10:105167581-105167603 CAGATAAGGCAGAAGACAGCAGG + Intronic
1074955226 10:118382234-118382256 CAGCGACAGGCGGAGGCAGCAGG + Intergenic
1075040055 10:119100953-119100975 CAGCAAAGGGAAAAGGCACATGG - Intergenic
1075207937 10:120462829-120462851 CACCGCAGGGTGGAGGCAGCAGG + Intronic
1075396818 10:122133692-122133714 CAGCGTGGGGAGAAGGCTTCTGG - Intronic
1075740019 10:124689603-124689625 CATCCAAGGAAGAAGGCAGGCGG + Intronic
1075812654 10:125236572-125236594 CCACGTAGGGAGAAGGCAGGAGG + Intergenic
1076562476 10:131376187-131376209 CAGAGATGGGAGCAGACAGCAGG + Intergenic
1076631397 10:131854300-131854322 GAGAGAAGGGAGAAGGCAGAAGG - Intergenic
1076676956 10:132152063-132152085 CTGCCATGGGAGAAGGGAGCAGG + Intronic
1077279334 11:1735020-1735042 CAGCGAGGGGAGAAGCCCCCAGG + Exonic
1078852998 11:15180769-15180791 CAGGGAAGGGGGAAAGCACCAGG - Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1080819401 11:35790890-35790912 CAGGGAAGGAACAAGGCAGTAGG + Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083263375 11:61535224-61535246 CAGAGACGGGCGAAGGCTGCCGG + Intronic
1083617257 11:64032445-64032467 CAGAGAGGGTAGATGGCAGCTGG + Intronic
1083687362 11:64384612-64384634 CACCGCAGGGAGCAGGCAGGAGG - Intergenic
1083696979 11:64449594-64449616 CAGCGAAGGAGGCAGGGAGCCGG - Exonic
1084612746 11:70214051-70214073 CAGCGAAGGGAGATAGGAGTGGG + Intergenic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085409900 11:76284688-76284710 CAGGGCAGGGTGAAGACAGCAGG + Intergenic
1085511155 11:77088818-77088840 CCACGAAGGGAGAAGGGAGGTGG + Intronic
1085587906 11:77728602-77728624 AAGGGAAGGGAGAAGGGAGACGG + Intronic
1086329932 11:85743884-85743906 CAGCTGAGGGAGGAGGGAGCAGG - Intronic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1089209642 11:116791539-116791561 AGGCGAAGGGAGGAGACAGCTGG - Intronic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089342450 11:117767628-117767650 CAGAGAGTGGAAAAGGCAGCTGG - Intronic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1090039320 11:123276480-123276502 AAGGGAAGGGAGAAGGCTGCAGG - Intergenic
1090491423 11:127164409-127164431 AGGCCAATGGAGAAGGCAGCTGG - Intergenic
1091183325 11:133627064-133627086 CAGCGAAGGGAGATAGGAGTGGG - Intergenic
1091200771 11:133778738-133778760 CATCTAAGGGTGAAGACAGCGGG - Intergenic
1092509084 12:9134810-9134832 CAGCCAGGGGTGGAGGCAGCTGG + Intergenic
1094311431 12:29087552-29087574 AAGGGATGGGAGCAGGCAGCAGG - Intergenic
1094639560 12:32260931-32260953 CAGACAAGGGAAAAGTCAGCGGG - Intronic
1095666140 12:44800966-44800988 GAGCCAAGGAAGAAGGCAACAGG + Intronic
1096076045 12:48805549-48805571 CAGAGAAGGGAGACAGCAGGAGG - Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101439952 12:104696106-104696128 CAGCAAAGGGAGCATGCAGATGG - Intronic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1101958620 12:109231682-109231704 TAGCCAAGGCAGAAGGCATCAGG + Intronic
1102149077 12:110676290-110676312 CAGCTGATGGAGAATGCAGCAGG - Intronic
1103965393 12:124635880-124635902 CACAGAAGGCAGAAAGCAGCAGG - Intergenic
1104907284 12:132220095-132220117 CAGCAAAATGACAAGGCAGCTGG + Intronic
1105604801 13:21918048-21918070 CAATAAAGGGAGAGGGCAGCCGG - Intergenic
1106117543 13:26830323-26830345 AAGCAAAGATAGAAGGCAGCAGG + Intergenic
1106389193 13:29318991-29319013 CCGGGAAGGAAGAAGGCAGCAGG - Intronic
1107005490 13:35604911-35604933 CAGCTGAGGAAGAAGGGAGCAGG - Intronic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1108286498 13:48914484-48914506 CAGCAAGGGCAGAAGGAAGCAGG - Intergenic
1108920751 13:55671651-55671673 CAGCGAAGGAAGATGGGAGAGGG + Intergenic
1109814058 13:67556081-67556103 CAGTGTAGGGAGAAGCCAGGTGG + Intergenic
1110410961 13:75203577-75203599 CATCATTGGGAGAAGGCAGCTGG - Intergenic
1110868002 13:80419949-80419971 AAGGGAAGGGAGAAGGGAGAAGG - Intergenic
1110935614 13:81284129-81284151 CAGCAAAGAGAGAATGCAGGGGG - Intergenic
1112015185 13:95325600-95325622 AAGGGAAGGGAGAAGGAAGGAGG + Intergenic
1112069790 13:95836785-95836807 CAGCAAAGGGAAAAGGCACATGG - Intronic
1112728222 13:102329505-102329527 CAGGGAAGGGAGTGGTCAGCAGG - Intronic
1113514842 13:110886184-110886206 CAGCCCAGGGAAGAGGCAGCGGG + Intronic
1116814482 14:49570704-49570726 CAGCAAAGGGAAAAGGCACATGG - Intergenic
1117460354 14:55939102-55939124 CAGAGTGGGGAGAAGGCAGTAGG + Intergenic
1118879949 14:69817446-69817468 AAGAGAAAGGCGAAGGCAGCAGG - Intergenic
1119182167 14:72612592-72612614 CAGGGAAGGGAGAGGGCAGGAGG + Intergenic
1119516777 14:75254602-75254624 CAGGGAAGGAAGAGGGCAACAGG - Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119778147 14:77260760-77260782 CTGCGCAGGGAGGAAGCAGCGGG + Intergenic
1119821117 14:77616773-77616795 CAGCGAAGGGAAAAAGCGGCGGG + Exonic
1119828767 14:77681952-77681974 CAGCAAAGGGAAAAGGCACCTGG - Intronic
1121456974 14:94044514-94044536 GAGCGGAGGGAGAATGCAGAGGG + Intronic
1121741484 14:96255308-96255330 CAGCAACAGGAGAAGACAGCAGG + Intronic
1121956552 14:98218585-98218607 GAGCAAAGGGAGTAGGCAGAGGG + Intergenic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1124431756 15:29614369-29614391 CAGCCAAGGAAGAAGGCTGAAGG - Intergenic
1125464063 15:39933971-39933993 AGGCGAAGGAAGAAGGCAGGGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1129198940 15:73987156-73987178 CAGTGAAGGGCTGAGGCAGCTGG + Intronic
1129713979 15:77836366-77836388 CAGGGAAAGGAGAGAGCAGCTGG - Intergenic
1129782376 15:78281301-78281323 AAGCCAAGGGAGAATGCTGCTGG + Exonic
1130722967 15:86408014-86408036 CAGCAAAGGCAGAGGGCAACTGG + Intronic
1130869881 15:87962146-87962168 CAGGGAAGGGAGAAAAAAGCTGG - Intronic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1134122742 16:11596544-11596566 CAGAGAGGGGAGGAGGCAGAGGG + Intronic
1134396207 16:13866179-13866201 CCACTAAGGGACAAGGCAGCTGG + Intergenic
1134404147 16:13940417-13940439 CAGCAAAGGGAAAAGGCACATGG + Intronic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1135500339 16:22990664-22990686 GGGAGAAGGGAGAAGGGAGCAGG - Intergenic
1135500341 16:22990671-22990693 CAAAGAAGGGAGAAGGGAGAAGG - Intergenic
1135840420 16:25871144-25871166 CTGTGAAGGAAAAAGGCAGCGGG + Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136145427 16:28313673-28313695 CAGGGATGGGAGCAGGCTGCAGG + Intronic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1137673837 16:50294058-50294080 CAGCCCAGAGAAAAGGCAGCGGG - Intronic
1138419457 16:56889872-56889894 CAGCTAAGGGAGTGAGCAGCTGG - Intronic
1139495049 16:67310368-67310390 CAGCAAAGCCAGAGGGCAGCTGG - Intronic
1139794775 16:69473640-69473662 CAGGGAAGGGAGAATTCAGTTGG - Intergenic
1140196489 16:72859731-72859753 CAGTGAGGGGAGAATGCGGCAGG + Intronic
1140887834 16:79260017-79260039 CAGCTAAGAGAGTGGGCAGCTGG + Intergenic
1140955113 16:79856492-79856514 GAAGGAAGGGAGAAGGCAGAAGG + Intergenic
1141096164 16:81164678-81164700 GAGCTGAGGGAGGAGGCAGCGGG + Intergenic
1141294178 16:82751400-82751422 CAGGGAAGTGAGGAGGCAGGAGG - Intronic
1141530315 16:84641733-84641755 GAGCCATGGGAGAAGGGAGCTGG + Intergenic
1141633111 16:85299577-85299599 CAGAGAACGGAGTAGGCAGAGGG - Intergenic
1141980729 16:87548301-87548323 GAGAGAGGGGAGAAGGCACCAGG + Intergenic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1142157495 16:88539291-88539313 CAGCTCAGGTAGAAGGGAGCAGG - Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142264346 16:89056921-89056943 CAGCCAAGGGCCAAGGCACCTGG - Intergenic
1142941748 17:3385881-3385903 GAGGGGAGGGAGGAGGCAGCCGG - Intergenic
1143340383 17:6206481-6206503 CAGCAAAGGGAAAAGGCTCCTGG - Intergenic
1143483835 17:7242143-7242165 CAGCGCAGGGATCAGGCTGCTGG - Intronic
1143500129 17:7334033-7334055 CAGGGAAGAAAGAGGGCAGCTGG + Intergenic
1143811013 17:9471828-9471850 CAGCAAAGGGAAAAGGCTCCTGG - Intronic
1144210678 17:13012517-13012539 GACTGAAGGCAGAAGGCAGCAGG - Intronic
1145122174 17:20269789-20269811 CAGCAAAGGGAAAAGGCACAGGG - Intronic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1145763166 17:27439350-27439372 CAGAGAAGGGATGAGGAAGCAGG - Intergenic
1146180263 17:30693726-30693748 CAAGGAAGAGAGAAGACAGCGGG - Intergenic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146371626 17:32268127-32268149 CAGAGTAGGGAGGAGGCAGGAGG - Intronic
1147606006 17:41774031-41774053 CAGCTAAGGGAGAGGGAAGCGGG + Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1148211795 17:45813214-45813236 AAGGGCAGGGAGGAGGCAGCAGG - Intronic
1149210443 17:54294395-54294417 TAGAGAAGGGTGAAGGCAGGTGG + Intergenic
1150375355 17:64676813-64676835 CTGAGAAGGCAGAAGGCAACTGG + Intergenic
1150455672 17:65304828-65304850 CAGCCAAGGGAGAAAACAGATGG + Intergenic
1150566765 17:66348768-66348790 CAGCAGAGGGGGAGGGCAGCTGG + Intronic
1152017013 17:77757341-77757363 CATCAAAGGCAGGAGGCAGCTGG + Intergenic
1152070283 17:78130866-78130888 CAGTGGAGGGAGAATGCAGAGGG + Intronic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1152586721 17:81192642-81192664 CAGGGATGGGAGAGGTCAGCGGG + Intronic
1152872751 17:82766780-82766802 CAGCAAAGGGAAAAGGCACATGG + Intronic
1153052941 18:917359-917381 CAGCGAAGAGAGAAAGGGGCAGG - Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153335690 18:3922052-3922074 CAGGGAATTGGGAAGGCAGCAGG + Intronic
1153711269 18:7802089-7802111 CAGAGAAGGGAGAGGGGAGAAGG - Intronic
1154349687 18:13572591-13572613 CAGGGAAGGGAAGAGTCAGCGGG + Intronic
1154982808 18:21517807-21517829 CAGCGAGGGCAGAAGAAAGCAGG - Intronic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1155324622 18:24653270-24653292 CAGCAAAGGGAAAAGGCACATGG - Intergenic
1155442010 18:25871880-25871902 AAGAGAAGGAAGAAGGAAGCGGG + Intergenic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1158464030 18:57673932-57673954 CAGGGAAGGGAGGACTCAGCAGG - Intronic
1158671094 18:59474516-59474538 AAGTGAAGGGAGAAGGCTGAGGG + Intronic
1159976804 18:74723539-74723561 CAAGGAAGAGAGAAGGCAGATGG - Intronic
1160008930 18:75089094-75089116 CAGCGGCAGGAGGAGGCAGCTGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1161238417 19:3209037-3209059 CACGGAAGGGAGACGGCTGCGGG - Exonic
1161560855 19:4971729-4971751 CAGCTCAGGGAGCAGGCAGGAGG + Intronic
1161620697 19:5295460-5295482 CAGCCAAGGGGGAGGGCACCTGG - Intronic
1161963472 19:7535273-7535295 AGGCGAAGGGAGCAGGAAGCCGG + Intronic
1162071003 19:8151963-8151985 AAGAGAGGGGAGAAGGAAGCCGG + Intronic
1162175122 19:8824616-8824638 CTGCGATGGGAGGAGGCAGAAGG - Intronic
1162221742 19:9183184-9183206 CACCCACGGGAGCAGGCAGCTGG - Intergenic
1162842173 19:13364578-13364600 CAGCCAAGGGGCAAGGGAGCTGG - Intronic
1162978337 19:14221814-14221836 CAAGGAAGAGAGAAGACAGCGGG + Intergenic
1163209333 19:15829076-15829098 CAGCGAAGGGAGATAGGAGAGGG - Intergenic
1163277868 19:16296805-16296827 CAGCGAAGCCAGCAGGCAGTGGG - Intergenic
1163585338 19:18160820-18160842 CAGCAAAGGGAGACTGCAGGGGG + Intronic
1163663857 19:18594163-18594185 CAGGGGAGGGGGAAGACAGCAGG - Intronic
1164003565 19:21129450-21129472 CAGCAAAGGGAGATAGGAGCGGG + Intergenic
1164726477 19:30468971-30468993 CAGGGAAGGGAGAAAGCCCCAGG - Intronic
1165336365 19:35172885-35172907 CAGCGCTGGGAGGAGACAGCTGG - Intergenic
1165361297 19:35338477-35338499 CAGGGAACGGGGAAGGCAGATGG + Intronic
1166119533 19:40677342-40677364 CAGCGACGGGAGAAGGAATGTGG - Exonic
1166344195 19:42155182-42155204 CAGAGAAAGATGAAGGCAGCCGG - Intronic
1167052968 19:47090890-47090912 CAGGGAAGGGGGCAGGCAGAGGG + Intronic
1167229032 19:48270062-48270084 CAGCGAAGGGAGATAGGAGAGGG - Intronic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1167743776 19:51339591-51339613 CAGCAAAGGGAGAAGTTACCTGG - Intronic
925034555 2:675802-675824 CAGGAAAGGGAGAAGGAACCAGG + Intronic
925059902 2:883014-883036 CAGGGAAGGCTGAAGGCAGAAGG + Intergenic
925182271 2:1825001-1825023 CAGAGAAGGGAGAGGACAGGAGG + Intronic
925437908 2:3857163-3857185 CAGCAAAGGCAGAAGACAGAGGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926644946 2:15280374-15280396 GGGAGAAGGGAGAAGGCTGCCGG + Intronic
927386556 2:22540887-22540909 CAGAGAAGAGTGAATGCAGCTGG - Intergenic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928019304 2:27689446-27689468 CAGCAAAGGGAGAAGGAACATGG + Intronic
929827629 2:45321705-45321727 GAGAGAAGGGAGAAAGCAGATGG + Intergenic
929864778 2:45708802-45708824 CAACAGAGGGAGAAGGCACCTGG - Intronic
930491297 2:52075953-52075975 CAGCGAAGGGAGATAGAAGTGGG - Intergenic
930690373 2:54356556-54356578 CATGGAAGGGAAAAGGAAGCAGG - Intronic
931091895 2:58895259-58895281 AAGTGAAGGGAGAAGACAGAAGG + Intergenic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
932875462 2:75446698-75446720 TAGAGAAGGGAGGAGGCAGAAGG - Intergenic
933854071 2:86396437-86396459 CAGCGAAGGGCGAAGGGGGTGGG - Intergenic
934695995 2:96400537-96400559 CAGCAAAGGGAGAACGCTGTCGG + Intergenic
935308467 2:101759781-101759803 AAGGGAAGGGAGAAGGGAGGGGG - Intronic
935523238 2:104135553-104135575 CAGGAAAGAGAGAAGGCAGCAGG + Intergenic
935523345 2:104136964-104136986 CAGGAAAGAGAGAAGACAGCAGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
937252618 2:120534120-120534142 CAGGGCTGGGAGCAGGCAGCTGG - Intergenic
938785856 2:134628742-134628764 CAGCAAAGGGAGACGGCACATGG - Intronic
938937580 2:136140584-136140606 GAGCCAAGGGAGGAGGCAGGGGG - Intergenic
939345665 2:140963934-140963956 CAGATAAGAGAAAAGGCAGCTGG + Intronic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944207421 2:197171244-197171266 GAGTGATGGGAGAAGGAAGCTGG + Intronic
944209991 2:197197229-197197251 AAGGGAAAGGATAAGGCAGCAGG + Intronic
944251983 2:197587602-197587624 CAGCGAAGGGAGAAAGGGGTAGG - Intronic
944796838 2:203195632-203195654 CAGCAAAGGGAAAAGGCACATGG + Intronic
945028000 2:205637640-205637662 CAGAGAGGGGAGAAGCCAGAAGG - Intergenic
945777569 2:214126184-214126206 CGGAGAAGGGAGAAGGGAGAAGG + Intronic
946606233 2:221408490-221408512 AAGCCCAGGGAGAAGGCAGTGGG - Intergenic
946885164 2:224215786-224215808 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
947805151 2:232961416-232961438 CAGCTAAAAGAGCAGGCAGCAGG - Intronic
947940633 2:234051908-234051930 GAGGGATGGGAGAAGGCAGCAGG - Intronic
948200609 2:236127435-236127457 GAAAGGAGGGAGAAGGCAGCGGG + Exonic
948585772 2:239018834-239018856 CAGCGTGGGAAGGAGGCAGCAGG - Intergenic
948756536 2:240162818-240162840 CAGCTGGAGGAGAAGGCAGCTGG - Intergenic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
948777848 2:240299167-240299189 CAAGGAAGGGACAAGGAAGCTGG - Intergenic
948879780 2:240850848-240850870 CAGCAATGGGGGACGGCAGCAGG - Intergenic
1169020915 20:2330227-2330249 CAGCAAAGGGAGAAAACAGCAGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170790686 20:19506969-19506991 CAGGCATGGGAGAAGGCATCTGG - Intronic
1170854572 20:20039289-20039311 CAGGCAAGGAAGAAGCCAGCAGG - Intronic
1171283233 20:23918632-23918654 GAGCCAAAAGAGAAGGCAGCAGG - Intergenic
1172447807 20:35002281-35002303 CAGGGAAGGCTGAAGGCAGCAGG - Exonic
1172510657 20:35498632-35498654 CAGCGGAGAGAGCAGTCAGCAGG - Exonic
1173239517 20:41281897-41281919 CAGCTGAGAGAGAAGGCAGAAGG + Intronic
1173537590 20:43828008-43828030 CAGCCAAGGGAAAAGGCACATGG - Intergenic
1173729224 20:45317040-45317062 CAGCAAAGGGGCAAGGAAGCAGG - Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1174358268 20:50012443-50012465 AAGAGAAGGGCCAAGGCAGCAGG - Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174518299 20:51110239-51110261 CAGAGAAGGAAAAAGGCAACAGG - Intergenic
1174833553 20:53835631-53835653 CAGCGAAGGGAAAAGGCACTCGG + Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176243257 20:64084740-64084762 CCGGGAAGGGAGGAGCCAGCTGG - Intronic
1176293513 21:5058793-5058815 CAGGGAAGAGGGAAGGCAGGAGG - Intergenic
1176968228 21:15235825-15235847 CAGGCAAGAGAGAAGACAGCAGG - Intergenic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1177840997 21:26233185-26233207 CAGCGAAGGGAGATAGGAGTGGG + Intergenic
1177844421 21:26272030-26272052 CAGCAAGGGGAGAAGGCACAGGG - Intergenic
1178310534 21:31526268-31526290 CAGGGAAGATGGAAGGCAGCGGG + Intronic
1179863747 21:44204855-44204877 CAGGGAAGAGGGAAGGCAGGAGG + Intergenic
1179875106 21:44263105-44263127 CAGGGAAGGGAGCAGGAAGGTGG + Intergenic
1181266855 22:21635511-21635533 GAGCTCAGGGAGAAGGTAGCAGG - Intronic
1181313201 22:21956567-21956589 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181346307 22:22222639-22222661 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181395153 22:22616230-22616252 CACCGAAGGGTGCAGGGAGCTGG + Intergenic
1181465960 22:23110764-23110786 CAGCAGAGGGAGGAAGCAGCTGG + Intronic
1181537489 22:23554132-23554154 CACCGAAAGGCGAAGGCAGCGGG - Intergenic
1181855089 22:25775544-25775566 CAGCGAGGGAAGAGGGCAGGAGG - Intronic
1181947482 22:26529451-26529473 CAGGGAGGGGAGAAGGCAGGTGG - Intronic
1182243426 22:28935651-28935673 AGGAGATGGGAGAAGGCAGCAGG - Intronic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1183568605 22:38634916-38634938 TAGCCCAGAGAGAAGGCAGCAGG + Intronic
1183637848 22:39075815-39075837 CAGCGAAGGGAGATAGGAGAGGG + Intronic
1183674257 22:39290920-39290942 CAGCCAGGGGAGCAGACAGCTGG - Intergenic
1183742521 22:39676834-39676856 AAGGGAAGGGAGAAGGCAGGAGG - Intronic
1183978784 22:41527923-41527945 CAGCGAAGGTCAGAGGCAGCAGG - Exonic
1184322936 22:43756858-43756880 AAGCAAAGGGAACAGGCAGCTGG + Intronic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1184461687 22:44641318-44641340 CAGCGGAGGCAGCAGACAGCAGG + Intergenic
1184951958 22:47849523-47849545 AAGGGAAGGGAGAAGGCAGGTGG + Intergenic
1185137966 22:49084116-49084138 CAGCTCAGAGAGCAGGCAGCTGG + Intergenic
950157224 3:10730765-10730787 CAGCGAAGGGAGATAGGGGCGGG - Intergenic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950806963 3:15613485-15613507 GAGAGAAGGGAGAAGGGAGTGGG - Intronic
951055579 3:18142943-18142965 CTGCTAAGGTAGCAGGCAGCTGG - Intronic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953237475 3:41119158-41119180 CATCCAAGGGACAAGGAAGCTGG + Intergenic
953619758 3:44522954-44522976 CAGCGAAGGGAGATAGGAGAGGG - Intergenic
953659399 3:44880590-44880612 CAGCAAAGGGAAAAGCCTGCTGG + Intronic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
953999254 3:47543006-47543028 CAGCGAAGGGAGGAGGGAGCCGG + Intergenic
954294336 3:49665867-49665889 CAGCTCAGGGAGAGGGCAGAAGG + Intronic
954935751 3:54325003-54325025 GAGGGGAGGGAGAAGGCAGAAGG + Intronic
954947831 3:54442188-54442210 GAGGCAAGGGAGAAGGCAGATGG - Intronic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
956325191 3:68044506-68044528 CAGCCAAGAGGGAAAGCAGCAGG - Intronic
956708915 3:72023411-72023433 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958047445 3:88303172-88303194 GAGAGAAGGGAGAAGGGAGAAGG - Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959822874 3:110757149-110757171 GAAAGAAGGGAGAAGGCAGAAGG - Intergenic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961124486 3:124404057-124404079 CAGGGAAGGGAGAAGAAAGGAGG + Intronic
961175021 3:124827991-124828013 CAGCGAAGGGAGCTGGCGGCGGG - Intronic
961355701 3:126338774-126338796 CAGGGAAGGGAGTGCGCAGCAGG - Intergenic
962812634 3:138972497-138972519 CAGAGACAGGAGAAGCCAGCTGG + Intergenic
963017502 3:140839839-140839861 CAGCCCAGGGAGAAGGCAGAGGG - Intergenic
964207441 3:154190058-154190080 CCATGAAGGGAGAAGGAAGCAGG - Intronic
964628536 3:158783327-158783349 CAGCAAAGGGAAAAGGCACATGG + Intronic
964673679 3:159254705-159254727 GAGGGAAGGGAGAAGGAAGGAGG - Intronic
964758157 3:160107470-160107492 CAGCAAAGGGAAAAGGCACATGG - Intergenic
964874117 3:161346870-161346892 CCACGGAGGGAGAAGGGAGCAGG + Intronic
965796622 3:172447547-172447569 GAGAGAAGGGAGAAGGCACAGGG + Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
967191704 3:186990595-186990617 GAGGGATGGGAGAAGGCGGCTGG - Intronic
967241059 3:187440020-187440042 CAGCAAAGGGAGAGGGTAGTTGG + Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968479636 4:827419-827441 GAGGGAAGGGTGAAGGCACCAGG + Intergenic
968582424 4:1401311-1401333 CAGCGGAGGGAGGAGGGAGGAGG + Intergenic
968858753 4:3149712-3149734 CAGAGAAGGGAGAAGACTGATGG - Intronic
969264779 4:6057338-6057360 CAGAGAAGGGAGGAGGGAGTTGG - Intronic
969566521 4:7982004-7982026 CAGAGAGGGGAGAAGGCACCAGG - Intronic
969997369 4:11326674-11326696 AAGAGAAGGGAGAGGGCTGCAGG + Intergenic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
972138142 4:35918881-35918903 CAGAGAAGTGAGAAAGGAGCTGG + Intergenic
972836429 4:42876127-42876149 CAGAGAAGGAAGAGGGTAGCAGG + Intergenic
974798720 4:66785851-66785873 CAGAGAATGGAGATGGCAGGAGG + Intergenic
975542715 4:75531399-75531421 CAGCTAAGGGAAAAGGCACATGG - Intronic
975707126 4:77122305-77122327 TAGAGAAGGAAGAAGCCAGCAGG + Intergenic
976390518 4:84499874-84499896 GAGCTAATGGAGCAGGCAGCCGG + Intergenic
977263159 4:94822562-94822584 AAGAGAAGGGAGAAGGGAGTTGG - Intronic
977805131 4:101288526-101288548 AGGAGAAGGGAGAAGGGAGCGGG + Intronic
978644656 4:110915601-110915623 CATGGAAGGGAGATGGTAGCCGG + Intergenic
978739232 4:112118993-112119015 AAGGGAAGGGAGAAGGAAACAGG + Intergenic
979147792 4:117267209-117267231 AAGAGAAGGGACAAGGCAGCAGG + Intergenic
980284647 4:130767687-130767709 CAGCGAAGGGAGATAGGAGTGGG - Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
982180825 4:152746810-152746832 CAGCGAAGGGAGATGGGGGTGGG + Intronic
982340476 4:154293075-154293097 CAGCCAAGGGTGAAGGAAGAGGG - Intronic
982424656 4:155244467-155244489 CAGAGAAGGGACACAGCAGCAGG + Intergenic
982612695 4:157596685-157596707 CAGCGAAGGGAGAAAGGGGTGGG + Intergenic
983106828 4:163697015-163697037 CAGCAAAGGGAAAAGGCACAGGG + Intronic
985625067 5:981607-981629 CAGAGTGGGAAGAAGGCAGCTGG + Intergenic
985754373 5:1704436-1704458 AAGAGAACGGAGAAGGCAGTGGG - Intergenic
985866706 5:2519645-2519667 CAGGGAAGGGAAAAGTCACCTGG - Intergenic
986236412 5:5914635-5914657 CAGAGCAGGTAGAAGGCATCCGG - Intergenic
987443636 5:17988136-17988158 CAGCTAATGGAGAAGGGACCAGG + Intergenic
987497646 5:18668944-18668966 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
987740800 5:21906782-21906804 GAGTAAAGGCAGAAGGCAGCTGG - Intronic
988617979 5:32793758-32793780 CAGCCAGGGGAGAAAGCAGGGGG - Intergenic
991671623 5:69054000-69054022 GAAGGAAGGGAGAAGGAAGCAGG + Intergenic
992269802 5:75053112-75053134 CAGCGGGGGGAAAGGGCAGCGGG - Intergenic
995256796 5:110056176-110056198 CAGAGAAGGGAGAGAGCAGCTGG + Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996647228 5:125830653-125830675 CAGAGAAGCCAGAAGTCAGCAGG + Intergenic
997236268 5:132274060-132274082 CAGGGAAGGGAGGAGGCAAAAGG - Intronic
998443130 5:142178797-142178819 CAAGGAAGGGAGCAGGCACCAGG + Intergenic
998948566 5:147367506-147367528 CAGCGAAGGGAGATAGGAGTGGG + Intronic
999694679 5:154178624-154178646 CACAGAGGGAAGAAGGCAGCTGG - Intronic
999875720 5:155803577-155803599 CAGAGAAGAGAGAGGGAAGCAGG + Intergenic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1000242473 5:159421369-159421391 CAGAGAAGGGAGAGAGGAGCAGG - Intergenic
1001548833 5:172587415-172587437 CAGAAAAGGGAAGAGGCAGCTGG + Intergenic
1002043902 5:176531714-176531736 AAGGGAAGGGAGCCGGCAGCTGG - Intronic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002679183 5:180948090-180948112 TGGAGATGGGAGAAGGCAGCTGG - Intronic
1003163026 6:3652090-3652112 CAGGGGAGGGAGAATGCTGCTGG - Intergenic
1003252965 6:4448134-4448156 CAGGAAAGGGAGACGGCATCTGG - Intergenic
1004008523 6:11658749-11658771 CATCCAAAGGACAAGGCAGCTGG - Intergenic
1004562295 6:16761760-16761782 CAGCGAAGGGTTAAGGGCGCGGG - Intergenic
1005027344 6:21476056-21476078 CAGCTAGGGGAGTAGGCAGGGGG + Intergenic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006937960 6:37731684-37731706 CATCGATGTGAGGAGGCAGCTGG - Intergenic
1006947807 6:37797068-37797090 CAGACAAGGGAGAAGGCAAAAGG - Intergenic
1007135947 6:39522089-39522111 CAGTGAAGGGAAAAGGCTGAAGG - Intronic
1007217154 6:40249247-40249269 CAGAGAAGGGAAAAGACAGGAGG + Intergenic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008835569 6:55823423-55823445 CAGCCAAGGGGGAATGCAGCAGG - Intronic
1010071204 6:71748460-71748482 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1011552242 6:88540456-88540478 CCGCCAAGGGAGAGGGCAGAGGG - Intergenic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013895118 6:115078724-115078746 CAGAGAAGGGAGTGGGCAACAGG + Intergenic
1017305646 6:152915095-152915117 AAGCAATGGGAGAAGGCTGCAGG + Intergenic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1018202429 6:161407958-161407980 CAGCGAAGGGAGATAGGAGAGGG - Intronic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018963892 6:168468464-168468486 CATGGCAGGGAGAAGGCAGTCGG - Intronic
1019429751 7:993202-993224 CAGGGCAGGGGGACGGCAGCTGG + Intergenic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020112643 7:5456191-5456213 CAGGGATGGGAGCAGGCAGCGGG - Intronic
1020208539 7:6139699-6139721 CAGGGCAGGGAGAATGCAGAGGG - Intronic
1020350136 7:7210468-7210490 GACAGAAGGGAGAAGGCAGAAGG + Intronic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023132055 7:37013226-37013248 CAGCCAAGGGACCATGCAGCAGG + Intronic
1023132389 7:37015641-37015663 AAGCCAAGGGAGAAGGCAGAGGG - Intronic
1023156457 7:37256753-37256775 AAGGGAAGGGAGAAGGGAGGAGG + Intronic
1023759676 7:43452963-43452985 TGAGGAAGGGAGAAGGCAGCAGG + Intronic
1023799813 7:43824123-43824145 CAGCAAAGGAAGGAGGGAGCGGG + Intergenic
1023867931 7:44247599-44247621 CAGGGAAGGGTCAAGGCGGCTGG + Intronic
1024193074 7:47032318-47032340 AAGTGAAGGGAGAAGACAGAAGG - Intergenic
1024261721 7:47578490-47578512 CAGCGAGGGTAGGAGGCAACAGG + Intronic
1026442793 7:70458644-70458666 CAACAAAGGGAGAAGGGAGGTGG - Intronic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1027978777 7:85189955-85189977 GAGCCATGGGAGAAGGCAGCAGG + Intergenic
1028382164 7:90211832-90211854 CAGCCAGGGGAGAAGGAAGGAGG - Exonic
1028815717 7:95141521-95141543 CAGAGAAGGGAGAGGAGAGCTGG - Intronic
1028984695 7:97000542-97000564 GAGCAAAGGGAGAAGGGAGGGGG - Intergenic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029657230 7:101935311-101935333 CAGCGAAGGGAGAAAGGGGTGGG - Intronic
1030347328 7:108449358-108449380 CAGTGAAGGGAGGGGGGAGCTGG - Intronic
1030418170 7:109271700-109271722 CAGCTGAGGGAGAATGGAGCTGG + Intergenic
1031079284 7:117242513-117242535 CAGCCAAGGGAGACAGCAGTGGG - Intergenic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032239091 7:130147641-130147663 CAGCGAGGGCTGGAGGCAGCCGG - Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032980222 7:137273477-137273499 AGTCGAAGGGACAAGGCAGCAGG + Intronic
1033153048 7:138933188-138933210 CAGGGAAGGGAGATGGTACCTGG + Intronic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034185124 7:149169905-149169927 CAGCAAAGGGAAAAGGTACCTGG + Intronic
1034226754 7:149490536-149490558 CAGGGCAGTGAAAAGGCAGCAGG + Intronic
1034828472 7:154288254-154288276 CAGGGATGAGAGGAGGCAGCAGG + Intronic
1034937556 7:155209838-155209860 CAGGGTAGGGGGAAGGGAGCGGG - Intergenic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035418474 7:158708075-158708097 CAGTGAACGGTGATGGCAGCGGG - Intergenic
1035681775 8:1493726-1493748 CTGCCCAGGGAGATGGCAGCAGG - Intergenic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1037281444 8:17246797-17246819 CAGCGAAGGGAAAGGCGAGCAGG + Exonic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1037852193 8:22340592-22340614 CACAGACGGGAGAAGGCAACAGG + Intronic
1039329158 8:36517608-36517630 TATTGAAGGGAGAAGGCAGATGG + Intergenic
1039547667 8:38421453-38421475 CAGCGGAGGGGGGAGGCTGCTGG + Intronic
1039745258 8:40419840-40419862 CAGGGAAGGAAGAAGGAATCTGG + Intergenic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041738917 8:61138712-61138734 CAGAGAAGGGGGAGAGCAGCAGG + Intronic
1042035566 8:64529775-64529797 CAGCAAAGGGAAAAGGCATATGG - Intergenic
1042339524 8:67664510-67664532 CAGGTGTGGGAGAAGGCAGCAGG - Intronic
1044337788 8:91008037-91008059 CAGCAAAAGGAAAAGGCAGATGG - Intronic
1044922470 8:97180614-97180636 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
1044934500 8:97279661-97279683 AAGCAAAGTGTGAAGGCAGCTGG - Intergenic
1045650311 8:104336194-104336216 CAAGGAAGGGAGAGGGCTGCAGG + Intronic
1046660764 8:116946234-116946256 CAACCAAGAGAGAAGGCAGCTGG - Intergenic
1046793541 8:118346733-118346755 CAACAAAGGGAAAAGGCACCTGG + Intronic
1047715696 8:127593107-127593129 CAGCAGAGGTAGAAGCCAGCAGG - Intergenic
1047808831 8:128385928-128385950 CAGAGGAGGGAGAAGCCATCTGG - Intergenic
1047916576 8:129590472-129590494 CTGCAAATGGAAAAGGCAGCTGG - Intergenic
1048045647 8:130770304-130770326 CTGGGGAGGGAGAAGGCAGGAGG + Intergenic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049672578 8:143876522-143876544 AAGGGAAGGGAGGAGGAAGCAGG - Intronic
1051808819 9:21027643-21027665 CCGTGAAGGAAGAAGGTAGCAGG + Intronic
1053110509 9:35455705-35455727 CAGAGAAGGTAGCAGGTAGCAGG + Intergenic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1053435124 9:38069149-38069171 GAGCGACGGAGGAAGGCAGCCGG + Exonic
1053539147 9:38955697-38955719 CAGCGAAGGGAGATAGGAGTGGG + Intergenic
1054626994 9:67408222-67408244 CAGCGAAGGGAGATAGGAGTGGG - Intergenic
1054806966 9:69404686-69404708 CAGCGAAGGGAGATAGGAGTGGG + Intergenic
1055266241 9:74498472-74498494 CAGCGAAGGGACATGCCTGCTGG - Intronic
1055625876 9:78176928-78176950 TGTGGAAGGGAGAAGGCAGCAGG - Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1056740713 9:89252156-89252178 CAGCAAAGGGTGAAGGTTGCTGG + Intergenic
1056950859 9:91039789-91039811 AAGAGAAGGGACAAGGCTGCTGG + Intergenic
1057448355 9:95134845-95134867 CAGGGGAGGGTGAAGGCAGGTGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058940953 9:109812224-109812246 CTGAGAAGGGAGAAGGGAGGAGG + Intronic
1059214738 9:112550591-112550613 CAGTGCAGGGAAAAGGCAGACGG + Intronic
1059448692 9:114356494-114356516 AAGGGAAGGGAGAAGGCGGAGGG - Intronic
1060103044 9:120856894-120856916 AAGCCAAGGGAGGAGCCAGCAGG + Exonic
1060188467 9:121577849-121577871 CAGCAGAGGGAGCAGGCACCAGG + Intronic
1060317963 9:122530708-122530730 CAGCGAAGGGAGATAGGAGTGGG + Intergenic
1061275742 9:129568750-129568772 CTGGGAAAGGAGAGGGCAGCGGG + Intergenic
1061297526 9:129685056-129685078 CAGCCCAGGGAGAGGGCAGGAGG - Intronic
1061879111 9:133559830-133559852 GAGTGAAGGGAGAAGGCATGGGG - Intronic
1062110314 9:134778663-134778685 CAGCACAGGGCGGAGGCAGCCGG - Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062604690 9:137341452-137341474 CAGCAAAGGGAAAAGGCACATGG + Intronic
1185449515 X:275082-275104 CAGTGAAGGGAGGAGGGAGGAGG + Intergenic
1185450598 X:279010-279032 CAGCGAAGGGAGATGGGGGAGGG + Intronic
1185786899 X:2898470-2898492 CAGCCACGGGGGCAGGCAGCGGG - Intergenic
1185857931 X:3553245-3553267 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1185862372 X:3591472-3591494 CAGCGAAGGGAGATGGGATGGGG - Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1187086050 X:16044813-16044835 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188498886 X:30804981-30805003 AAGGCAAGGGAGAAGGCAGAAGG - Intergenic
1190299336 X:49047457-49047479 GAGCGAAGTGGGAGGGCAGCTGG + Intergenic
1190988656 X:55522926-55522948 CAGCCAAGGGAGGAGGGTGCAGG + Intergenic
1192050390 X:67719132-67719154 CAGGGTTGGGAGAGGGCAGCTGG - Intronic
1192184339 X:68936504-68936526 CAGAGAAGGGAGGAGAGAGCTGG + Intergenic
1192670439 X:73134857-73134879 CAGCAAAGGGAGAAGGCCCATGG + Intergenic
1194367580 X:93028513-93028535 CAGTGAAGGGAGATGGGAGTGGG - Intergenic
1194661264 X:96630327-96630349 CAGCGAAGGGAGATAGGAGTGGG - Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1198015069 X:132602216-132602238 CTGGGATGGGAGAAAGCAGCAGG + Intergenic
1198277045 X:135104852-135104874 CAGCAAAGGGGCATGGCAGCTGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199600256 X:149537434-149537456 GAGAGGAGTGAGAAGGCAGCAGG + Intergenic
1199609884 X:149604266-149604288 CAGCAGAGGGGCAAGGCAGCAGG - Intronic
1199650328 X:149942506-149942528 GAGAGGAGTGAGAAGGCAGCAGG - Intergenic
1199651346 X:149947923-149947945 CTGGGAAGGGAGAAGGAAGGAGG - Intergenic
1200022475 X:153223876-153223898 AAGGGAAGGGAGAAGTCAGGTGG - Intergenic
1200675784 Y:6144772-6144794 CAGTGAAGGGAGATGGGAGTGGG - Intergenic
1202022995 Y:20486953-20486975 GAGGGAAGGGGGAAGGGAGCAGG + Intergenic