ID: 1017706961

View in Genome Browser
Species Human (GRCh38)
Location 6:157132411-157132433
Sequence CAGCGCAAGCCTGCAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017706956_1017706961 29 Left 1017706956 6:157132359-157132381 CCAACAGGTTTGAAGGAGAAAGT 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1017706961 6:157132411-157132433 CAGCGCAAGCCTGCAGTTGTTGG 0: 1
1: 0
2: 1
3: 8
4: 99
1017706955_1017706961 30 Left 1017706955 6:157132358-157132380 CCCAACAGGTTTGAAGGAGAAAG 0: 1
1: 0
2: 1
3: 24
4: 224
Right 1017706961 6:157132411-157132433 CAGCGCAAGCCTGCAGTTGTTGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017706961 Original CRISPR CAGCGCAAGCCTGCAGTTGT TGG Intronic
900342714 1:2196292-2196314 CAGCCCATGCCTGCAATTCTAGG + Intronic
901163761 1:7199706-7199728 CAGTGCAGTCCTGCAGTTGGTGG + Intronic
904595789 1:31644567-31644589 CAGCGCCAGCCTGGACCTGTGGG + Intronic
906533056 1:46534370-46534392 CAGCCCAAGCCAGCCGATGTGGG - Intergenic
908001417 1:59684076-59684098 CAGCACAAGCCTGCATGTGACGG + Intronic
912456699 1:109802900-109802922 CACCCCAATCCTGCAGCTGTGGG - Intergenic
923730489 1:236545252-236545274 CAGTGCAAGCAAGCAGTTTTAGG - Intronic
1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG + Intergenic
1065598570 10:27344756-27344778 CAGCACATGCCAGCAGGTGTTGG - Intergenic
1067507834 10:46871708-46871730 CAGCAGGAGCCCGCAGTTGTGGG + Intergenic
1067654417 10:48180137-48180159 CAGCAGGAGCCCGCAGTTGTGGG - Intronic
1069798665 10:71069113-71069135 CAGAGCAGGCCTGGGGTTGTTGG + Intergenic
1073178687 10:101571080-101571102 CAGCGGACGCCTGGAGCTGTGGG + Intronic
1080620741 11:33985684-33985706 CAGCGCGCGCCTGCAATTGCAGG - Intergenic
1081771602 11:45653534-45653556 CAGAGCAGGCCTGCACTTGCAGG - Intronic
1083546367 11:63551999-63552021 CAGTGCAAGCTTGAAGCTGTGGG + Intergenic
1089421265 11:118332591-118332613 CGGCGCACGCCTGCAATTGCAGG + Intergenic
1090207363 11:124893153-124893175 CAGAACAAGTCTGCAGTTCTGGG - Intronic
1090712720 11:129402207-129402229 CAGCAGAAGCCTGCAGCTTTGGG + Intronic
1090968676 11:131620721-131620743 CAGTGCAGGCCTGCAGGTGGTGG - Intronic
1094647054 12:32335716-32335738 TAGTGCAAGCCTGCAGTCCTAGG - Intronic
1102869490 12:116402481-116402503 GAGTGCAACCCTGCAGTGGTTGG - Intergenic
1104329271 12:127828946-127828968 CACCGCAAGCATGTAGTTTTTGG - Intergenic
1105016304 12:132788035-132788057 CAGCCCAGGCCTGCAGCTGTGGG + Intronic
1106196308 13:27497177-27497199 AAGCCCCAGCCTGCAGTGGTTGG - Intergenic
1109378382 13:61525844-61525866 CTGCGAGAGCCTGCAGTTGTTGG + Intergenic
1110564285 13:76942206-76942228 CAGAGAAATCCTGCAGTTGAGGG + Intergenic
1111485738 13:88896161-88896183 CTGCTCAGGCCTGCATTTGTTGG + Intergenic
1118550536 14:66944930-66944952 TTGCGCATGCCTGCAGCTGTTGG + Intronic
1120991738 14:90383327-90383349 CGGCGCGACCCTGCAGTGGTTGG - Intergenic
1202917466 14_GL000194v1_random:190112-190134 CGGCGCACGCCTGCAATTGCAGG - Intergenic
1125969243 15:43898736-43898758 CAGCCCAAGCCTACAGCTGCTGG - Intronic
1126807036 15:52361261-52361283 CAGCCCAAGCCCACAGTTGTAGG + Intronic
1128603076 15:69014402-69014424 CAGGGCCTGCCTGGAGTTGTTGG + Intronic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1130726776 15:86447367-86447389 CAGGGAAAGCCTGAAGCTGTTGG + Intronic
1131830092 15:96348656-96348678 CAGAGCAAACCTGCAGTTGTGGG - Intergenic
1133228858 16:4356921-4356943 CAGCCTAAGCCGGCAGTTCTGGG - Intronic
1134420482 16:14083369-14083391 AAGCCCAAGCCTGCTGTAGTTGG + Intronic
1135910101 16:26552522-26552544 CACCAGACGCCTGCAGTTGTTGG - Intergenic
1142996147 17:3761694-3761716 CAGCACACTCCTGCAGGTGTCGG - Intronic
1143405980 17:6677469-6677491 CAGGGCAAGCCTGAAGCTGCGGG + Intergenic
1147339449 17:39745099-39745121 CAGTCCAAGCCTGAAGTTATAGG + Intronic
1147995689 17:44359196-44359218 CAGAGCAAGCCTGCAGTTCCTGG - Intronic
1152382524 17:79949425-79949447 CAGCCCCAGCCTTCAGCTGTGGG + Intronic
1156534976 18:37853714-37853736 AAGAGTAAGCCTGCAGTGGTGGG - Intergenic
1157425268 18:47579339-47579361 CAGGACAGGCCTGCTGTTGTGGG + Intergenic
1158634942 18:59148185-59148207 CTTCACAATCCTGCAGTTGTTGG - Intronic
1163232874 19:16015937-16015959 CAGTGCAGTCCAGCAGTTGTTGG + Intergenic
1163986238 19:20953291-20953313 CAGCGCACGCCTTCAGTCGCAGG + Intergenic
1164064900 19:21707482-21707504 CAGCGCACGCCTGCAATCGCAGG - Intergenic
1164822543 19:31261199-31261221 CAGACCCAGCCTGCAGTTCTTGG - Intergenic
925840807 2:7990123-7990145 CAGAGCAAGCCTGCCTTTCTTGG - Intergenic
929152060 2:38756570-38756592 CGGCGCACGCCTGCAGTCGCAGG + Intronic
929402314 2:41598774-41598796 CAGTGGAAGCATCCAGTTGTTGG + Intergenic
934911157 2:98255587-98255609 CACCGCCAGCCAGCAGCTGTGGG + Intronic
937750277 2:125468639-125468661 TAGCACAAGCCTTCAGTTGTTGG - Intergenic
937987131 2:127642891-127642913 CAGCCCGGCCCTGCAGTTGTGGG - Intronic
940001160 2:148967334-148967356 CAGCCCCAGCCTACACTTGTCGG - Intronic
1169592884 20:7164378-7164400 CAGCCCATGACTGCAGCTGTGGG + Intergenic
1173380942 20:42540539-42540561 CAGAGCAAGCCAGCAGCTCTGGG + Intronic
1178290720 21:31365782-31365804 CAGTGAAATCTTGCAGTTGTTGG - Intronic
1180198609 21:46211863-46211885 CTGCACAGGCCTTCAGTTGTTGG - Intronic
1180869189 22:19136915-19136937 CGGCTCAAGCCTGGTGTTGTAGG - Intronic
950737487 3:15021713-15021735 CAGCGGAAGCCTGCAGTCCTGGG - Intronic
952048115 3:29348867-29348889 CAGCCCAAGTCTGCAGTAGAAGG + Intronic
953455201 3:43035256-43035278 CAGAGCAAACCTGCAGATGCAGG - Intronic
953854963 3:46494043-46494065 CAGCGCGTGCCTGCAATTGCAGG - Intergenic
954216197 3:49125806-49125828 CTGTGCAAGCCTGGAGTGGTTGG - Exonic
954523186 3:51248323-51248345 CAGCGCGCGCCTGCAATTGCAGG - Intronic
956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG + Intergenic
960697923 3:120413922-120413944 CGGCGCAAGCCTGCAATCGCAGG - Intronic
966905555 3:184522403-184522425 CAGCGGAAGCCTGCTGGTGGGGG + Intronic
967233670 3:187365019-187365041 AAGCCCCAGCCTGAAGTTGTAGG + Intergenic
969029916 4:4203647-4203669 CATCTTAAGCCTGCAGGTGTAGG - Intronic
986093804 5:4536594-4536616 CAGCCCAGGCCTGCAGGTGAGGG - Intergenic
988923310 5:35963846-35963868 CTGCTCATGCCTGTAGTTGTCGG + Intronic
992643569 5:78791625-78791647 TGGCCAAAGCCTGCAGTTGTTGG - Intronic
992962840 5:81972460-81972482 CAGCACAGGCCTGCAGTTACCGG - Intronic
998074315 5:139224008-139224030 CAGCGCACGCCTGCAATCGCAGG - Intronic
999935323 5:156479949-156479971 CAGGGCAAGACAGCAGCTGTTGG - Intronic
1000350494 5:160349082-160349104 CACCCCCAGCCTACAGTTGTGGG + Exonic
1000954880 5:167531247-167531269 TAAAGCAAGCCTGCAGTTCTTGG - Intronic
1006180347 6:32150397-32150419 CAGTGCAAGGCTGCAGCTGCAGG + Exonic
1009865774 6:69395912-69395934 CAGGGCAAGCCAGCAGCTGGAGG - Intergenic
1012518691 6:100093628-100093650 CAGGGCCAGCATGCAGTTGAAGG + Intergenic
1017706961 6:157132411-157132433 CAGCGCAAGCCTGCAGTTGTTGG + Intronic
1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG + Intergenic
1019981204 7:4623479-4623501 CGGCGCACGCCTGCAATTGCAGG - Intergenic
1021647238 7:22800377-22800399 CAGCGCGCGCCTGCAATCGTAGG - Intergenic
1022182987 7:27940009-27940031 CAGGGCCAGACTGCAGGTGTTGG + Intronic
1023257943 7:38330466-38330488 CAACACAACCCTGGAGTTGTAGG + Intergenic
1023261977 7:38367706-38367728 CAGCACAACCCTGGAGTAGTAGG + Intergenic
1023709155 7:42973653-42973675 CAGCAGAAGCCTCCAGCTGTTGG - Intergenic
1027150184 7:75728078-75728100 CAGAGCAAGCATGCAGTAGATGG - Intronic
1030754127 7:113268212-113268234 CAGTGCAAGACTGAAGTGGTAGG + Intergenic
1034100350 7:148445412-148445434 CAGCGCCAGCCAGCAGTGCTGGG + Intergenic
1034978164 7:155459706-155459728 CAGCGCCAGCCCGCAGTGGTGGG + Intronic
1037447662 8:18983220-18983242 CAGAGCAAGCCTCCAATTCTTGG - Intronic
1040523027 8:48193951-48193973 CAGAGCAAGGCTGCTGTTATGGG - Intergenic
1048254919 8:132898392-132898414 CAGCGCAAGCTTGCAGGCCTGGG - Intronic
1057578001 9:96259381-96259403 CAGCGCAAGTCAGTTGTTGTGGG + Intronic
1059148362 9:111922589-111922611 AATGGCAAGACTGCAGTTGTGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1187308479 X:18118699-18118721 CAGGGCAAGCCAGCAGTGGTGGG + Intergenic
1188212795 X:27444063-27444085 TAGCACATGCCTGCAGCTGTTGG + Intergenic
1194553871 X:95333469-95333491 CAGAGCCAGACTGCAGTTATTGG - Intergenic
1198579645 X:138049305-138049327 CAGGGGAAGGCTGCAGTTGGGGG - Intergenic
1200358570 X:155578164-155578186 CAGTGCAAGCAGGCACTTGTGGG - Intronic