ID: 1017707910

View in Genome Browser
Species Human (GRCh38)
Location 6:157140809-157140831
Sequence TGGAAGGCCGCTGCCTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017707910 Original CRISPR TGGAAGGCCGCTGCCTCTCC CGG (reversed) Intronic
900408458 1:2502552-2502574 TGGGTGGCCGCTCCCTCTGCAGG - Intronic
900538915 1:3193140-3193162 TGGTAAGCCGCTGCGTCTGCTGG - Intronic
901064762 1:6489459-6489481 AGGAAGGCCCCTTCCTCCCCAGG + Intronic
902618816 1:17638711-17638733 GGGAGGGCTGCTGCCTCTGCTGG + Intronic
905404065 1:37721566-37721588 TGGAGTGCCCCTGCCTCTCCAGG - Intronic
908766390 1:67558510-67558532 TGGAAGGCCGCTCTAGCTCCAGG - Intergenic
912356218 1:109056109-109056131 TTGAAGGCTGCTGCTTTTCCTGG - Intergenic
915004435 1:152623323-152623345 TGGGAGGCAGCTGACACTCCTGG + Intergenic
917602923 1:176595445-176595467 TGCAGGGCCGCTGCTACTCCTGG + Exonic
919895255 1:202005726-202005748 TGCATGGCCCCTGCCTCTTCAGG + Exonic
920443073 1:205994354-205994376 TGGAAGGGTGGTGACTCTCCAGG + Exonic
922816909 1:228455875-228455897 TGGAAGGCTACACCCTCTCCTGG + Intergenic
924775408 1:247112141-247112163 TGGGAGGCCGCTGGCGGTCCAGG + Exonic
1062829113 10:593566-593588 AGGAGGGCCCCTGCCTCTGCTGG - Intronic
1063145600 10:3292548-3292570 TCGAAGGCCAGTGCCTTTCCAGG + Intergenic
1064145689 10:12824326-12824348 TGGCTGGCCGCTGCCCTTCCAGG - Intronic
1064472102 10:15646358-15646380 TGGAAGGCCACAGGCACTCCAGG - Intronic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1070954418 10:80454733-80454755 TGGACGGCCGCTGCTGCTCGGGG + Intronic
1071220693 10:83461708-83461730 TGGAAGGCTACTCCCTCTCTAGG - Intergenic
1074198196 10:111207759-111207781 GGGAAGGCCTCTGACTCTTCAGG + Intergenic
1074813677 10:117128864-117128886 TGTAAGGGAGCAGCCTCTCCAGG + Intronic
1075377920 10:121994494-121994516 TGGAAAGCCGCTGCCTGGCCTGG + Intronic
1076618087 10:131770160-131770182 TGGATGCCTGCTGCCTTTCCAGG - Intergenic
1076698488 10:132258168-132258190 AGGGGGGCAGCTGCCTCTCCTGG + Intronic
1077304706 11:1863918-1863940 GGGGAGGCTGCTGCCTTTCCTGG - Intronic
1078032058 11:7762630-7762652 TTGAAAGCCTCTCCCTCTCCAGG - Intergenic
1078532100 11:12144530-12144552 GGGAAGAACGCTGCCTCTCCAGG - Intronic
1080002846 11:27370482-27370504 TGGAAGCCTGCTGCCTCCTCTGG + Intronic
1080886440 11:36372392-36372414 GGGAGGGCCTCTGCTTCTCCTGG + Intronic
1082013395 11:47466609-47466631 AGAAAGGCAGCTGCCGCTCCAGG + Intronic
1083933125 11:65856958-65856980 TGGATTGCCCCTCCCTCTCCTGG - Intronic
1084330064 11:68424995-68425017 TGGAAAGCCCCTGCCTCTCAGGG - Intronic
1084673881 11:70623252-70623274 TGCATGGCCTCTGCCCCTCCAGG + Intronic
1084939780 11:72606381-72606403 TGGAAGGCAACTGCTTCTTCTGG - Intronic
1085040333 11:73323121-73323143 TGGAAGTGCCCTGCCTCTCAGGG + Intronic
1085208085 11:74749103-74749125 GGCAGGGCCGCTGCTTCTCCGGG - Exonic
1086520276 11:87661221-87661243 TGGTATGCTGCTGGCTCTCCTGG - Intergenic
1088835987 11:113578321-113578343 TGGAAGGACTCTGCCTTTCTGGG + Intergenic
1089139718 11:116275929-116275951 TGGGAGGTCCCTGCCTCTGCTGG - Intergenic
1092905940 12:13101028-13101050 AGAAAGGCGGCTTCCTCTCCTGG - Intronic
1092979057 12:13775413-13775435 AGGAATGCACCTGCCTCTCCGGG + Intronic
1095716008 12:45346762-45346784 TGGAAGGCCCTTGGCTGTCCTGG - Intronic
1100142799 12:91639315-91639337 TGGAAGGCCAATGCCTATCCAGG - Intergenic
1102551808 12:113696772-113696794 AGGATGGCCACTCCCTCTCCAGG - Intergenic
1102955227 12:117054592-117054614 AGGAAGGCCCCTGCAACTCCAGG + Intronic
1103144889 12:118586956-118586978 AAGAAGGCTGCTGCATCTCCAGG + Intergenic
1103713523 12:122929888-122929910 TGGGGGGCCCCTGCTTCTCCCGG - Exonic
1104346162 12:128001162-128001184 TGGCATCCCTCTGCCTCTCCGGG - Intergenic
1104940751 12:132393569-132393591 TGGACGGGCGCTGACTCACCAGG + Intergenic
1107964997 13:45589898-45589920 TGGAGGGGGGCTGCCTCGCCGGG + Intronic
1112589526 13:100750535-100750557 AGGAGGGACGCTGCCTCTCCTGG - Intergenic
1113811194 13:113143715-113143737 TGCAAGCCCGCTGCCCCTCCGGG + Intronic
1113835004 13:113322850-113322872 TGGAATGCCGCTGTCTCTGAGGG + Exonic
1116786525 14:49294510-49294532 TGGCATGCTGCTGCCTCTCAGGG + Intergenic
1121882711 14:97514975-97514997 TGGAGGGCAGCCTCCTCTCCAGG - Intergenic
1122650929 14:103226709-103226731 TGGCAGGGCCCTGCCTCCCCAGG - Intergenic
1124158764 15:27250854-27250876 TGGACGGCAGCTGCTCCTCCTGG + Intronic
1124178160 15:27446798-27446820 TGGAGGGCCACTGACTCCCCTGG - Intronic
1125581342 15:40788158-40788180 GGGGAGGCATCTGCCTCTCCGGG - Intronic
1130813348 15:87405421-87405443 TGGATGGCAGCTGCTTCTCACGG - Intergenic
1131215319 15:90530623-90530645 TGGAAGGCCGCGGGCACCCCAGG + Intronic
1134264808 16:12683864-12683886 AGGGAGGGCGCAGCCTCTCCAGG + Intronic
1135382775 16:22008248-22008270 CGTGAGGCCGCTGCCTGTCCGGG + Exonic
1135737252 16:24942027-24942049 TAGCAGGCCGCTTCCTCTCCAGG + Exonic
1136609619 16:31358198-31358220 TGGAAGGGGGTTTCCTCTCCAGG + Intronic
1137742971 16:50798904-50798926 GGGAAGGACGCAGCCTCCCCAGG - Exonic
1138096646 16:54217164-54217186 TGGAGGGCAGCTGTCTCCCCAGG + Intergenic
1138482696 16:57314305-57314327 TGGATGGCCTCTCCCTCCCCAGG + Intergenic
1142068606 16:88076779-88076801 CTGAAGGCCGCTGCCTCCGCGGG + Exonic
1142108344 16:88318194-88318216 AGGGAGGCCGCTGGTTCTCCAGG + Intergenic
1142232976 16:88908469-88908491 TGCAAAGCGGCTTCCTCTCCCGG - Intronic
1142260475 16:89040451-89040473 TGGAAGGCGGCAGCCACTCCAGG + Intergenic
1142472679 17:172094-172116 TAGGAGGCCGATGCCACTCCAGG - Intronic
1143675065 17:8426557-8426579 TGGGAGGCAGCTGCCACTCTGGG + Intronic
1144949398 17:18985811-18985833 TGGAAGGCAGCTGGCACTGCAGG - Intronic
1145750196 17:27349664-27349686 TGGGCGGCTGCTGCCGCTCCCGG - Intergenic
1146183210 17:30709898-30709920 TGGGAGGCCGGGGCCTGTCCTGG + Intergenic
1147200755 17:38799715-38799737 GGGGCGGCCGCTGCCTCCCCGGG - Exonic
1147548255 17:41419834-41419856 TGGGAGGCAGCAGCCTCTCTGGG + Intergenic
1151215450 17:72573973-72573995 TGGCAGGTGGCTGCCTCTACAGG - Intergenic
1151887137 17:76929760-76929782 TGGGGGGCTGCTGCCTCTCCTGG + Intronic
1152200003 17:78939756-78939778 TGGAGGGCAGCGGCCACTCCAGG + Intergenic
1152717107 17:81905477-81905499 GCGACGGCCGCTGCCTCCCCGGG - Intronic
1152783559 17:82236904-82236926 TGCACGGCCCCTGCCCCTCCTGG - Intronic
1161073817 19:2275473-2275495 AGGAATGCAGCTGCCCCTCCAGG - Exonic
1161285782 19:3467577-3467599 TGGAATGCTGCTGTCTCTCAAGG - Intronic
1161420373 19:4173287-4173309 GGGAAGGCAGCTGCCTTCCCGGG + Intergenic
1161990755 19:7682807-7682829 TGGAGGGCCGCTGACCCTGCCGG + Exonic
1162793701 19:13075947-13075969 GGGATGGCCGCAGCCCCTCCTGG + Intronic
1162975584 19:14205876-14205898 TGGGAGGCCGGGGCCTGTCCTGG - Intronic
1164398774 19:27888562-27888584 TGGCAGGCTGCTGGCTCTGCAGG + Intergenic
1164890494 19:31819641-31819663 TGGAAGGCGGGGGCTTCTCCTGG + Intergenic
1165903340 19:39178847-39178869 GGGAGGGCCGCTGCCCTTCCTGG - Exonic
1166966861 19:46534101-46534123 GGGAAGGCCGGTGCCCCTCCTGG + Intronic
1167236512 19:48319065-48319087 TGGAAGGCCTCTGGGTCTTCTGG + Intronic
1168028245 19:53659523-53659545 TGGAAAGGGGCTCCCTCTCCTGG - Intergenic
1168349831 19:55669413-55669435 TGTGACGCCGCTGCCTCCCCTGG + Intronic
926090549 2:10046179-10046201 TGTCATGCCGCTTCCTCTCCAGG - Exonic
927155377 2:20218185-20218207 TGGCAGGCCATTGCCTCTCTGGG - Intronic
927552276 2:24010532-24010554 GGGAAGGACGCAGCCTCCCCAGG - Intronic
931162594 2:59709757-59709779 TCGAATGCCCCTGCCTCTTCTGG + Intergenic
932490446 2:72116518-72116540 TGGAAGTCCTGGGCCTCTCCAGG - Intergenic
934661635 2:96146290-96146312 GGGAAGTCCGCTGACGCTCCCGG + Intergenic
936376020 2:111942128-111942150 TGCAAGCCTGCTGCCACTCCCGG + Intronic
938626970 2:133121036-133121058 TTAAAGGTCGCTGCCTATCCAGG - Intronic
940328505 2:152450931-152450953 TGGCAGGTCGCTGGGTCTCCAGG + Intronic
942210089 2:173661247-173661269 TAGATGGCTGCTGCCTCTCAGGG - Intergenic
943956194 2:194193104-194193126 TGGCAGACCACTGCCTCTGCTGG - Intergenic
944205982 2:197158839-197158861 TTGAAGGCTGCTGCATCTTCAGG - Intronic
944540273 2:200747702-200747724 TGGCAGGCCTCTGCCTCCTCAGG + Intergenic
949028570 2:241777611-241777633 TGGCAGGTCCCTGCCTCCCCGGG + Intronic
1169074779 20:2753859-2753881 CCCAAGGCCCCTGCCTCTCCTGG + Intronic
1172010075 20:31841450-31841472 TGGGAGCCCACTGCCTTTCCAGG - Intergenic
1172150412 20:32786534-32786556 GGGAAGGCCTGTGCCTCTCCCGG - Exonic
1173100893 20:40087436-40087458 TGGGAGGCAGCTGCCTACCCTGG - Intergenic
1173820227 20:46014601-46014623 GAGAAGGCCTCTGCCTCTGCTGG - Intronic
1175470464 20:59223492-59223514 TGGAGCACCGCTGCCTCTGCTGG - Intronic
1175796639 20:61775319-61775341 TGGAAGCCCGCTCCCTGTCTCGG - Intronic
1175935934 20:62514081-62514103 TGCAGGGACGCCGCCTCTCCAGG + Intergenic
1180081024 21:45487578-45487600 TGCAAGGCCGGTGGCTCTCAGGG - Intronic
1180843566 22:18970230-18970252 TGCAGGGCCGCCGCCTCTTCAGG + Intergenic
1181474803 22:23161525-23161547 TGGAGGGCCTCTTGCTCTCCTGG - Exonic
1181625445 22:24119525-24119547 GGGAAGGCCACTGGCTCCCCTGG - Exonic
1183483476 22:38077261-38077283 GGGAAGGCGGCTTCCTCTGCAGG + Intergenic
950141730 3:10620519-10620541 TGGAAGGACGGTGCAGCTCCCGG + Intronic
950418015 3:12879669-12879691 AGGAAGGCCACTGACTTTCCAGG + Intergenic
950687535 3:14629159-14629181 TGGGAGGCCCCAGCCTCTTCAGG - Intergenic
950741981 3:15059302-15059324 AGGAAGGACGCAGTCTCTCCAGG + Intronic
956359908 3:68436822-68436844 AGGAAGGCAGATGCCTTTCCTGG + Intronic
956629904 3:71305975-71305997 TGGAAGCCTGCTGGCTCTCAGGG + Intronic
960352218 3:116607417-116607439 TGGAGGGCAGCTGCCTCACACGG + Intronic
961525740 3:127496315-127496337 TGCTTGGCCTCTGCCTCTCCTGG + Intergenic
961641235 3:128365916-128365938 TGGATGGCCAATGTCTCTCCCGG + Intronic
962890773 3:139670852-139670874 AAGAAGGCCATTGCCTCTCCTGG - Intronic
968069141 3:195775134-195775156 TGGAAACCCGCAGGCTCTCCTGG + Intronic
968697568 4:2040655-2040677 GGGAGGGCCGCTGCCTCCCCAGG + Intronic
968804492 4:2763592-2763614 GGGAAGACCCCTGCCCCTCCTGG - Intergenic
969414091 4:7047620-7047642 AGGAAGACAGCTGCCTCACCTGG + Intronic
969449228 4:7263680-7263702 AGCAAGGCTGCTGACTCTCCTGG + Intronic
969722552 4:8900558-8900580 TGGGAAGCCGCTGCCACCCCAGG + Intergenic
971592899 4:28491917-28491939 TGGATGGCTTCTGACTCTCCAGG + Intergenic
974260373 4:59518336-59518358 AGGAAGGCCCCTGCCCCTGCAGG - Intergenic
978646723 4:110942068-110942090 TGGATGGCTGGAGCCTCTCCTGG + Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
981655185 4:147104924-147104946 TGAAAGGCTGCTGCGTTTCCTGG + Intergenic
984640318 4:182157759-182157781 TGGAACGCCCTTACCTCTCCTGG - Intronic
985025766 4:185737652-185737674 GAGAAGGCGGCTGCCTCTGCGGG + Intronic
986353650 5:6903573-6903595 GGGATGGCCACTGCCTCACCTGG + Intergenic
987075948 5:14381946-14381968 TGGAAGGACTCAGCCTCTGCAGG - Intronic
989099953 5:37814068-37814090 TGGAAGGCCCCTGTGTCTCCCGG + Intronic
990955721 5:61336294-61336316 TGGAAGGGAGCTGCCTCTATAGG + Intronic
994449210 5:99919817-99919839 TGGAAGGGCGTTGCCGCTGCTGG - Intergenic
998435926 5:142108841-142108863 TCGATGGCCGCCGCCGCTCCCGG - Exonic
998458105 5:142289388-142289410 GGCAAGGCCGCTGGCACTCCAGG - Intergenic
1001396348 5:171421465-171421487 TGGAAGGCAGGTGGCTTTCCGGG + Intronic
1005497480 6:26400838-26400860 AGGAGGGCCGCTGCACCTCCAGG + Intergenic
1006171670 6:32096773-32096795 TGGACGGCCGCTGCGTGTGCTGG - Intronic
1006517389 6:34552566-34552588 TGGAGGGCCTCTGCCTTCCCTGG - Intronic
1007228908 6:40334526-40334548 AGAAAGGCCGCTGACTCCCCAGG - Intergenic
1010160694 6:72850653-72850675 TGGAAGAATGCTGCCTTTCCAGG + Intronic
1014158549 6:118139534-118139556 TGGAAGGATGCTGACTTTCCAGG + Intronic
1015822869 6:137281901-137281923 TGGATTGCCCCTGTCTCTCCAGG - Intergenic
1017707910 6:157140809-157140831 TGGAAGGCCGCTGCCTCTCCCGG - Intronic
1018060606 6:160086895-160086917 TGGAAGGCACCTGCTTCCCCTGG + Intronic
1018442023 6:163822240-163822262 TGCAGGGCAGCTGCCTCTGCAGG + Intergenic
1019406693 7:887720-887742 GGGCAGGCGGCCGCCTCTCCAGG + Intronic
1020120262 7:5499223-5499245 AGGGAGGCTGCTCCCTCTCCCGG + Intronic
1020806887 7:12801241-12801263 TTGAGGGCCGATGACTCTCCCGG - Intergenic
1021953814 7:25803443-25803465 GGGAAGGCCCCTGATTCTCCTGG + Intergenic
1023985549 7:45092490-45092512 AGGGAGGCAGCAGCCTCTCCTGG - Intergenic
1027052981 7:75031299-75031321 TGGAACGCCGCTGCTGCTGCTGG - Intronic
1028402028 7:90434270-90434292 TGGGAAGCCCCTGCCTCTGCAGG - Intronic
1029537688 7:101165705-101165727 TGGAGGGTGCCTGCCTCTCCCGG + Intergenic
1031178152 7:118378881-118378903 AGGAAGGGGGCTGCATCTCCTGG + Intergenic
1031971103 7:128065767-128065789 TGGAAGGCAGCCTTCTCTCCTGG + Intronic
1032202050 7:129829068-129829090 TGCAAGGCCTCTGCAGCTCCAGG + Intergenic
1032803023 7:135331638-135331660 GAGCAGGCCGCTGCTTCTCCTGG + Intergenic
1033474077 7:141674118-141674140 GGGCAGGCTGCTGCCTCTGCCGG + Exonic
1034458768 7:151186690-151186712 TGGAAGGTCTCTGCCTTCCCTGG - Intronic
1035482537 7:159198818-159198840 TGGGAGGCTGCTGCCTCTAACGG - Intergenic
1035654911 8:1298337-1298359 TGGAAGGACGCGGCCTCTGTAGG - Intergenic
1036453766 8:8891650-8891672 TGGACGGCCGATGCCTCCCGGGG - Exonic
1039797863 8:40930777-40930799 TGGGAGGCTGCTGCATCTTCAGG - Intergenic
1045004262 8:97903561-97903583 GGGAAGGACTCTGCCTCTCCTGG + Intronic
1045346223 8:101295957-101295979 TGGAAGAAATCTGCCTCTCCAGG - Intergenic
1048272461 8:133040500-133040522 TGGAAGGCTGCGGCTTCTGCAGG - Intronic
1048296731 8:133220310-133220332 TGGAAGGACGCAGCCTCCCGAGG - Intronic
1049253662 8:141602757-141602779 TGGAAGGCAGCTGTCTCCTCAGG + Intergenic
1049545792 8:143229909-143229931 TGGATGCCCGCTTCCTGTCCTGG - Intergenic
1051403059 9:16704752-16704774 TGGGAGGCCGCTGCAGCTCATGG - Intronic
1053419776 9:37970011-37970033 TGGAAGGCTGGTGTCTCTGCCGG + Intronic
1056241627 9:84653635-84653657 TAGAAGGCTGCTGCTGCTCCTGG + Intergenic
1056274002 9:84975061-84975083 TGGAAGGCGGCACCCTCCCCCGG + Intronic
1060407578 9:123380492-123380514 TGGAAGGCAGCTGGCCTTCCTGG - Exonic
1061922238 9:133788573-133788595 TGGCACGCGGCTCCCTCTCCGGG + Intronic
1062179722 9:135184855-135184877 TCGCAGGCCGTCGCCTCTCCGGG + Intergenic
1062538458 9:137031177-137031199 TGGCACGCAGCTGCCGCTCCTGG + Exonic
1185445093 X:253706-253728 GGGAAGGCCCCTGCCCATCCCGG + Intergenic
1191224325 X:58026185-58026207 TGGAAGACAGCTCCCTCTGCTGG + Intergenic
1192583278 X:72301967-72301989 GGGATGGCTGCTGCCACTCCAGG - Exonic
1195709802 X:107764903-107764925 CCGAAGGCCTCTGCCTCCCCAGG + Intronic
1200247375 X:154533341-154533363 GGGAAGGCCATTGCCTCTCTGGG - Intronic