ID: 1017709596

View in Genome Browser
Species Human (GRCh38)
Location 6:157155412-157155434
Sequence GTCCACGAAGGGCTCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017709596_1017709600 -2 Left 1017709596 6:157155412-157155434 CCCTGAGAGAGCCCTTCGTGGAC No data
Right 1017709600 6:157155433-157155455 ACTAACTGAGCATCAGAAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017709596 Original CRISPR GTCCACGAAGGGCTCTCTCA GGG (reversed) Intronic