ID: 1017709596

View in Genome Browser
Species Human (GRCh38)
Location 6:157155412-157155434
Sequence GTCCACGAAGGGCTCTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017709596_1017709600 -2 Left 1017709596 6:157155412-157155434 CCCTGAGAGAGCCCTTCGTGGAC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1017709600 6:157155433-157155455 ACTAACTGAGCATCAGAAGAAGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017709596 Original CRISPR GTCCACGAAGGGCTCTCTCA GGG (reversed) Intronic
900207070 1:1436130-1436152 CTCCACTAAGGGCCCTCGCAAGG - Intronic
900585465 1:3430491-3430513 GTGCACGAGGGGCACCCTCAGGG - Intronic
900981644 1:6049269-6049291 GTACACGAGGGGCACTCCCATGG + Intronic
903515050 1:23904720-23904742 GTCCATGAAGTGCTCTCTGTAGG + Intronic
903650206 1:24917355-24917377 GTCAACGGTGAGCTCTCTCATGG - Intronic
904650312 1:32000686-32000708 GTCCAGGAAGGTCTCTCTCGGGG - Intergenic
912093213 1:106107720-106107742 GCCCAGTGAGGGCTCTCTCATGG - Intergenic
1067287945 10:44921181-44921203 GTCCATGAATGGCTCCATCAAGG + Intronic
1067831049 10:49611159-49611181 GTCGATGAAGGGCCCGCTCAAGG - Exonic
1071471377 10:85986336-85986358 GCCCATCAAGGGCTCTCCCAGGG - Intronic
1073206582 10:101772631-101772653 GTCCAAGAACTGCTTTCTCAGGG - Intronic
1082194590 11:49287006-49287028 ATCCAGGAATGTCTCTCTCAAGG + Intergenic
1082790928 11:57346382-57346404 GTCAACCAAGGGCTCACTCTAGG + Intronic
1082978233 11:59096475-59096497 GTCCACGAAGGGCTAGATAAGGG - Intergenic
1084241772 11:67826190-67826212 GTCCAGCAAGGCTTCTCTCACGG - Intergenic
1086590460 11:88509056-88509078 CTCCTCGCAGGGCTCCCTCATGG - Exonic
1089493744 11:118898534-118898556 CTCCCCGCAGGGCTCCCTCATGG - Exonic
1090913770 11:131144533-131144555 ATCCACGAAGAGCTCTGTCCAGG - Intergenic
1092306855 12:7310360-7310382 GTGCTCCAAGGGATCTCTCAGGG + Intronic
1093636126 12:21470968-21470990 GTCCACGCAGAACTCTTTCAGGG - Exonic
1101803764 12:108045637-108045659 GTCCACGAAGGTATAACTCAGGG + Intergenic
1104482018 12:129115831-129115853 GTCAACGCAGGGAGCTCTCAGGG + Intronic
1104679548 12:130739894-130739916 GTCCCCAAAGGGCCCTCTCCTGG - Intergenic
1105858917 13:24392781-24392803 ATCCACGAAGGGCTCCCTGCAGG - Intergenic
1106041570 13:26098272-26098294 GTCCATGGAGGGCTCCCTCCAGG - Intergenic
1109094526 13:58096306-58096328 GTCCAAGCAGGGCCATCTCAAGG + Intergenic
1110893341 13:80717074-80717096 CACCACAAAGGGCTCTCCCAAGG - Intergenic
1113741684 13:112715929-112715951 TCCCACTAAGGGCTCTCTGAGGG + Intronic
1118222389 14:63867188-63867210 GTCCATTAAGAGTTCTCTCATGG - Intronic
1118930223 14:70234357-70234379 GTCCAGGAAGGGCTGTCCCATGG - Intergenic
1123457643 15:20440424-20440446 GTACATGGAGGCCTCTCTCAGGG + Intergenic
1123660428 15:22559998-22560020 GTACATGGAGGCCTCTCTCAGGG - Intergenic
1124263790 15:28215571-28215593 GTACATGGAGGCCTCTCTCAGGG + Intronic
1124314283 15:28654483-28654505 GTACATGGAGGCCTCTCTCAGGG - Intergenic
1127521272 15:59745393-59745415 GTCAACTATGGGCTCCCTCAAGG + Intergenic
1127699169 15:61480374-61480396 GTCCACAAATGGCTGCCTCAAGG - Intergenic
1128212474 15:65912285-65912307 GTCTTTGCAGGGCTCTCTCAAGG - Intronic
1136710844 16:32235125-32235147 GTCCAGGAAGGGGTCTCTGCTGG - Intergenic
1136757066 16:32694286-32694308 GTCCAGGAAGGGGTCTCTGCTGG + Intergenic
1136811043 16:33176089-33176111 GTCCAGGAAGGGGTCTCTGCTGG - Intergenic
1136817519 16:33286169-33286191 GTCCAGGAAGGGGTCTCTGCTGG - Intronic
1136824083 16:33342698-33342720 GTCCAGGAAGGGGTCTCTGCTGG - Intergenic
1203059215 16_KI270728v1_random:954637-954659 GTCCAGGAAGGGGTCTCTGCTGG + Intergenic
1144596516 17:16574580-16574602 GTCCATGAAAGTCTGTCTCATGG + Intergenic
1148686121 17:49502181-49502203 GTCCAGGCAGGGCTCACACACGG - Exonic
1160017514 18:75155783-75155805 GTCCGCGAGGGGGTCTCGCATGG + Intergenic
1162793352 19:13074280-13074302 GTCCAAGAAGGTCTCTGTCTTGG + Intronic
1162839344 19:13344451-13344473 GTCCAAGAAGGCTTCTCTGATGG - Intronic
1163146243 19:15380576-15380598 GTCCAAGAAGTCCTCCCTCATGG - Exonic
1166496031 19:43303849-43303871 GTCAAGAAAGGGCTCTTTCAAGG - Intergenic
928433426 2:31238818-31238840 GTCCAGGGAGGCCTCCCTCATGG - Intronic
938168506 2:129054611-129054633 GTCCACTAAGGGCTGCCTCTGGG - Intergenic
939288604 2:140164512-140164534 GTCCACCAATGCCTCACTCAGGG + Intergenic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1175286273 20:57838965-57838987 GTCCACGCATGTCTCTCTCTTGG + Intergenic
1175814849 20:61878002-61878024 GTCCACGAAGTCCTCCCTCTGGG - Intronic
1178056751 21:28807660-28807682 CTCCACTAAGGACTCTCTCCAGG - Intergenic
1179937612 21:44615101-44615123 GTCCAGGAGGGCCTCTCACATGG - Intronic
1180195473 21:46191112-46191134 GGCCAGCAAGGGCTCTCTCAGGG + Exonic
1181029779 22:20144134-20144156 GTCCACCCAGGGCTCTCCCTGGG + Intronic
1181563133 22:23717186-23717208 TGCCACGACGGGCTCTCTCGGGG + Intergenic
1185406363 22:50654096-50654118 ATCTTCGAAGGGGTCTCTCAGGG - Intergenic
952929437 3:38347726-38347748 GTCAACGAAGGGCGGTCACAGGG - Intronic
956630483 3:71312106-71312128 GTCCACCAAGGGCTTGCTAAAGG + Intronic
959670392 3:108970763-108970785 GTCTACAAAGGGCTCCCGCAGGG - Intronic
968976940 4:3827027-3827049 CTCCAGGAAGGGCTCTCTCCTGG + Intergenic
969122205 4:4918947-4918969 TTGCACAAAGGGCTCTCTCTAGG + Intergenic
971857955 4:32067268-32067290 ATCCATGAATGGCTCACTCATGG - Intergenic
976699623 4:87955681-87955703 GTCAAGGAAGGCCTCTCTGAGGG - Intergenic
981589135 4:146338151-146338173 GTCCACAAATGTTTCTCTCATGG + Intronic
985477921 5:90296-90318 GTCAAGGAAGGCCTCTCTGATGG - Intergenic
985762195 5:1755041-1755063 GTCCAGGGAGGGCTCCCTCCTGG - Intergenic
992743112 5:79793660-79793682 GTCCAGGCAGGGCTCTCTGAGGG + Intronic
999229318 5:150052415-150052437 GTCCCCCAAGTGCTCTCTCGGGG - Exonic
1002966534 6:1971561-1971583 GTAGACTAAGGGCTCTCACAGGG + Intronic
1006406680 6:33849623-33849645 GTCCACCCAAGGCTCTCCCATGG - Intergenic
1006751372 6:36380020-36380042 GTCCACACAGGGCTGTCACAAGG + Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1016769200 6:147829676-147829698 GTCCACCAAGAGCTCTTTCCAGG + Intergenic
1017709596 6:157155412-157155434 GTCCACGAAGGGCTCTCTCAGGG - Intronic
1018646208 6:165951081-165951103 GGCCATGAAGGTCTTTCTCAAGG + Intronic
1023819909 7:43974925-43974947 GTCCAGGAAGTGACCTCTCAGGG - Intergenic
1029748184 7:102528378-102528400 GTCCAGGAAGTGACCTCTCAGGG - Intergenic
1029766131 7:102627465-102627487 GTCCAGGAAGTGACCTCTCAGGG - Intronic
1030924082 7:115430179-115430201 ATACATGAAGTGCTCTCTCATGG + Intergenic
1034263441 7:149771012-149771034 GGCCTCCAAGGTCTCTCTCATGG + Exonic
1037324213 8:17672559-17672581 GTCCAGGAAGAACACTCTCAAGG - Intronic
1042123545 8:65513688-65513710 ATCCAAGAAGTGCTCTCTCCAGG + Intergenic
1042576565 8:70227110-70227132 GCCCACAAAGGGCTGCCTCATGG - Intronic
1044624874 8:94227279-94227301 GTCCTGGAAGGGCTCCCACATGG + Intergenic
1045683657 8:104689111-104689133 GTCAAGGCAGGGCACTCTCAAGG - Intronic
1047448858 8:124944365-124944387 GTCCAAGAAGGTCTCTTTGAAGG - Intergenic
1048973915 8:139660743-139660765 GTCCAGGAGGGGCTGTCTCCTGG - Intronic
1049126734 8:140795932-140795954 TTCCAGGAAGGGCTCTCTGCCGG - Intronic
1049551947 8:143264103-143264125 GTCCAAGAAGGCTTCTCTAAGGG - Intronic
1049682956 8:143927853-143927875 GGCCACCAAGGCCTCTCTGAAGG - Exonic
1051019235 9:12521013-12521035 CTCCAGGAAGGCCTCTCTGAAGG - Intergenic
1058705630 9:107635991-107636013 GTCAAAGAAGGTTTCTCTCAGGG + Intergenic
1186184312 X:7005215-7005237 TTCCAAGAAGGGCTGTTTCATGG + Intergenic
1186365926 X:8893325-8893347 GTCCACGAATGGTTCTTTCAGGG + Intergenic
1192923825 X:75735172-75735194 GTTCACAAAGGGCACTATCATGG - Intergenic
1195201142 X:102551299-102551321 GTCCACACAGGGCTCTCTTAAGG - Intergenic
1199563265 X:149186848-149186870 CTCCAGGAAGGTCTCTGTCAGGG + Intergenic
1200059877 X:153479481-153479503 CTCCAGGGAGGGCTCTCTCAGGG - Intronic