ID: 1017711290

View in Genome Browser
Species Human (GRCh38)
Location 6:157170605-157170627
Sequence ATGGCTCCAGACTCTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017711285_1017711290 2 Left 1017711285 6:157170580-157170602 CCTGAGATTATGCCAAAGTATGT 0: 1
1: 0
2: 0
3: 17
4: 142
Right 1017711290 6:157170605-157170627 ATGGCTCCAGACTCTGTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 186
1017711288_1017711290 -10 Left 1017711288 6:157170592-157170614 CCAAAGTATGTGGATGGCTCCAG 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1017711290 6:157170605-157170627 ATGGCTCCAGACTCTGTAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017711290 Original CRISPR ATGGCTCCAGACTCTGTAGG TGG Intronic
904712996 1:32445138-32445160 ATGGCCCATGACTCTGGAGGGGG + Intergenic
905428780 1:37906202-37906224 TTGGCTACAGACTCTGTACAGGG + Intronic
907426912 1:54385533-54385555 ATGGATCCTGAGTCTGAAGGAGG + Intronic
907481953 1:54751073-54751095 CTGACTCCAGAGTCTGTAGCTGG + Intergenic
907773248 1:57487154-57487176 ATGGAACCAGACTTTGGAGGTGG + Intronic
912980455 1:114366380-114366402 ATGGCCCACGACTCTGGAGGGGG + Intergenic
913446872 1:118959476-118959498 GAGGCTCCAGATTCTGTAGCTGG + Intronic
916521226 1:165565045-165565067 ATGGGTCCAGACTCAGGAGCTGG + Intergenic
918731237 1:188000232-188000254 TTGGATTCAGACTTTGTAGGAGG + Intergenic
920234377 1:204493305-204493327 ATGGCACCAGATTCTTTAGCAGG - Intronic
920381567 1:205537381-205537403 ATGGTTCCAGACTCTGTGCCAGG + Intergenic
921074600 1:211690155-211690177 ATGGCCCATGACTCTGGAGGAGG - Intergenic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
923356280 1:233159086-233159108 CTGGCTCCTGATTCTGTAGGTGG + Intronic
923988686 1:239410411-239410433 ATGGTTTCTGACTCTCTAGGCGG - Intronic
924772789 1:247090823-247090845 ACTGCTCCGGACTCTGCAGGAGG + Intergenic
1065930963 10:30478765-30478787 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1067767641 10:49099004-49099026 ATGGATCCTGTCTCTGAAGGCGG + Intronic
1068671835 10:59730887-59730909 ATGGCCCACGACTCTGGAGGGGG + Intronic
1072934347 10:99697987-99698009 GAGGCTCCAGGCTCTGCAGGTGG + Intronic
1073429853 10:103479031-103479053 ATGGCTCCAGCCTGGGTGGGTGG + Exonic
1073844173 10:107533421-107533443 AAGGCTGCAGACTCTGTCAGTGG + Intergenic
1074776415 10:116771098-116771120 GTGGCTCCCGAGTCTGTAGATGG + Intergenic
1076616045 10:131755179-131755201 ATGGATCCACACTGTGCAGGTGG - Intergenic
1077303236 11:1856648-1856670 AGAGCTCCAGATTCTGAAGGAGG + Intronic
1078271243 11:9796906-9796928 ATGGCTCCACAGTCTGTATACGG - Intronic
1078824977 11:14920831-14920853 ATGCATCTAGACTATGTAGGTGG + Intronic
1083060399 11:59864202-59864224 GTGGCTGCAGACTGTGTTGGTGG + Intronic
1083375926 11:62221066-62221088 ATGGCCCATGACTCTGGAGGTGG - Intergenic
1083972630 11:66090103-66090125 ATGGATCCAAACTATTTAGGAGG - Intronic
1085468089 11:76737793-76737815 ATGGATCAAGACCCAGTAGGAGG - Intergenic
1087140583 11:94761741-94761763 ATGGCTCCAGACACTCTAGATGG - Intronic
1087225808 11:95596734-95596756 ATTGCTACAGACTCTGTAGTAGG - Intergenic
1091045182 11:132318833-132318855 ATGGCTGTAGACTTTGGAGGTGG + Intronic
1096207681 12:49737089-49737111 ATGGCCCACGACTCTGGAGGGGG - Intronic
1097787844 12:63780257-63780279 CTGGCTCGAGAGGCTGTAGGGGG - Intronic
1098488395 12:71047628-71047650 AAGACTCCAGACTCGGTAGAGGG - Exonic
1100141859 12:91628751-91628773 TTAGATCCAGACTCTGTGGGTGG + Intergenic
1100398341 12:94204568-94204590 AGGCCTCCAGACTCTTTAAGAGG - Intronic
1102606348 12:114070589-114070611 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1104291621 12:127474548-127474570 ATAGCTAGAGACTCTGGAGGTGG - Intergenic
1107146658 13:37067640-37067662 GTGTCTCCAGTTTCTGTAGGAGG + Intergenic
1107166839 13:37292371-37292393 ACGGCTCAAGACTCTGCATGAGG + Intergenic
1108494777 13:51014241-51014263 ATGGGTACAGACTCTGTGGCTGG + Intergenic
1110653752 13:77972849-77972871 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1113384994 13:109840541-109840563 ATGGCCTCAGACTGTGTACGTGG + Intergenic
1113706763 13:112439855-112439877 ATGGCTCCAGAAACTAGAGGTGG + Intergenic
1114146071 14:19979705-19979727 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1114223580 14:20718414-20718436 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1114236131 14:20825264-20825286 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1114576116 14:23715275-23715297 ATGGCTCATGACTCACTAGGTGG - Intergenic
1118770072 14:68936896-68936918 ATGGCTGCAAACTCTGGATGAGG - Intronic
1119381292 14:74230504-74230526 ATGACTCAAGACACTGGAGGAGG + Intergenic
1121433503 14:93903681-93903703 GGGGCTCCAGACTCTGCAGTTGG + Intergenic
1121586382 14:95065712-95065734 TTTGCTCCAGACCCTTTAGGAGG + Intergenic
1121639290 14:95474611-95474633 ATGGCTCCTGCCTCTGGATGAGG + Intronic
1126317790 15:47388851-47388873 TTGGCTCCAGATTTTCTAGGAGG + Intronic
1129743536 15:78002119-78002141 ATGGAAACAGCCTCTGTAGGTGG - Intronic
1135407758 16:22210219-22210241 ATGGCTCCAGAGTCAGAAGGTGG + Intronic
1138478269 16:57284646-57284668 GTGGCTCCAGGCGCTGCAGGAGG + Exonic
1138772106 16:59678116-59678138 TTGGCTTCATACTTTGTAGGTGG + Intergenic
1139354647 16:66360266-66360288 ATGGCTCCAGACAACGGAGGAGG + Intergenic
1141621416 16:85238449-85238471 TTGGCTCCGGGCTCTGCAGGCGG + Intergenic
1143747625 17:9005263-9005285 ATGGCTCTAGAATCTGTGGAAGG - Intergenic
1145275648 17:21427981-21428003 ATGACTCCAGGATCTGTAGCAGG + Intergenic
1145313497 17:21713890-21713912 ATGACTCCAGGATCTGTAGCAGG + Intergenic
1145711948 17:26985868-26985890 ATGACTCCAGGATCTGTAGCAGG + Intergenic
1148820564 17:50357234-50357256 CCGGCTCCAGAGTCTGGAGGTGG + Exonic
1152625265 17:81385227-81385249 ATGGCTGCAGACACTGGGGGAGG - Intergenic
1153514682 18:5892294-5892316 CTGGCTCCAGCCTCTGTACACGG - Intronic
1153982071 18:10318792-10318814 AATGCTCCAGGCTCTGTGGGAGG - Intergenic
1154463195 18:14617275-14617297 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1155618835 18:27752433-27752455 AGGGTACCAGACTCTGTGGGGGG + Intergenic
1158591121 18:58779689-58779711 ATTGCTCCAGACTTTGAGGGAGG + Intergenic
1162087322 19:8256608-8256630 ATGGCTTCAGAGTCTGCAGCAGG - Exonic
1162923842 19:13919711-13919733 AAGGCCCAAGACTCTATAGGTGG + Intronic
1163162796 19:15475625-15475647 CTGGCTCCAGCCTCTGTAGAAGG + Exonic
1163650566 19:18515478-18515500 ATGGGTGGAGACTCTGGAGGAGG - Intronic
1163867131 19:19782914-19782936 ATGGCCCAAGACTCTGGAGGGGG + Intergenic
1163991809 19:21005940-21005962 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1164121610 19:22270281-22270303 ATGGCCCATGACTCTGGAGGGGG + Intergenic
1164130766 19:22359212-22359234 ATGGCCCACGACTCTGGAGGGGG + Intergenic
1164216999 19:23159301-23159323 ATGGCCCATGACTCTGGAGGGGG + Intergenic
1164427371 19:28153627-28153649 AGGGCCCCAGACTCTATAGAAGG - Intergenic
1165834460 19:38745667-38745689 ATGGCTCCAGAGTCCTTTGGGGG - Intronic
1167513571 19:49909806-49909828 ATGGCTCCGGACTCTGGTGGCGG + Exonic
1168597766 19:57693014-57693036 ATGGCTCCAGGCTGTGCTGGGGG - Intronic
925332783 2:3071690-3071712 GTGGCTCCAGAATCTGTACCTGG + Intergenic
926491498 2:13530381-13530403 ATGGCCCACGACTCTGGAGGGGG + Intergenic
926974713 2:18502921-18502943 GGTGCTCCTGACTCTGTAGGTGG + Intergenic
927718807 2:25369974-25369996 CCCACTCCAGACTCTGTAGGGGG - Intergenic
927789896 2:26001856-26001878 TTGGCTCCTTACACTGTAGGAGG + Intergenic
928123903 2:28603064-28603086 ATGGCTCCAGCCTCTGGAAGGGG - Intronic
928219380 2:29391033-29391055 GGGGCTCCAGGCTCTGTAGGGGG + Intronic
930871635 2:56176914-56176936 ATAGCTACAGACTATGTGGGGGG - Intergenic
933389512 2:81652421-81652443 ATGGCCCACGACTCTGGAGGGGG + Intergenic
933657720 2:84903475-84903497 TTGGCTCCAGACTTTGTATTGGG - Intronic
934745095 2:96754145-96754167 AAGGCTCCAGTCTATGTAAGCGG - Intergenic
935721525 2:105983529-105983551 ATGGCCCACGACTCTGGAGGGGG + Intergenic
938703120 2:133897083-133897105 ATGGCCCAAGACACTGGAGGGGG - Intergenic
940352778 2:152707393-152707415 ATGGCCCATGACTCTGGAGGGGG - Intronic
941349333 2:164413381-164413403 ATCCCTCCACACTCTGTAGAAGG - Intergenic
941395033 2:164963782-164963804 CTGGCTCCAGAAGCTGGAGGAGG + Intergenic
943505220 2:188747098-188747120 ATGAGACCAGACTCAGTAGGTGG - Intronic
945483440 2:210367940-210367962 ATGGCCCATGACTCTGGAGGGGG + Intergenic
945720248 2:213410126-213410148 ATGGCCCACGACTCTGGAGGGGG - Intronic
947980085 2:234401166-234401188 AGGGATCCAGGCTCTGAAGGAGG + Intergenic
948250421 2:236524039-236524061 ATGTCTTCAGACTCTGAAAGAGG + Intergenic
948447226 2:238042400-238042422 ATGGCTCCAGGCCCTGCCGGTGG + Exonic
1168824156 20:797998-798020 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1172210070 20:33191190-33191212 ATGACTCCAGGCTGTGGAGGGGG + Intergenic
1174269672 20:49358604-49358626 ATGGTGCCAGCCTCTGTACGAGG + Intergenic
1175908046 20:62391522-62391544 ATCGCTCCAGCCTCGGTTGGTGG - Intronic
1175995012 20:62808100-62808122 CTGGCTCCTCACTCTGCAGGTGG - Intronic
1176811326 21:13541095-13541117 ATGGCCCATGACTCTGGAGGGGG + Intergenic
1179959734 21:44761365-44761387 ATGTTTCCAGACTCTGGTGGTGG - Intergenic
1179960129 21:44763524-44763546 ATGGCCCCAGCCTCTGTGCGGGG - Intergenic
1180834497 22:18923075-18923097 ACAGCACCAGACTCTGCAGGTGG + Intronic
1180867312 22:19126990-19127012 ATGGCTCTGGACACTGTCGGAGG - Intergenic
1181842066 22:25671686-25671708 CTGGCTGTAGAGTCTGTAGGAGG + Intronic
1182368412 22:29793862-29793884 ATGGCTCCAGCCACTTTAGAGGG + Intronic
1183723613 22:39576486-39576508 GTTTCTCCAGACTCTGCAGGTGG - Intronic
1184951711 22:47847754-47847776 AAGGCTCCAGCCTGTGAAGGTGG + Intergenic
1185068486 22:48643719-48643741 ATGGCACCAGCTACTGTAGGTGG + Intronic
1203284586 22_KI270734v1_random:148374-148396 ACAGCACCAGACTCTGCAGGTGG + Intergenic
950846185 3:16018101-16018123 ATGGCCCATGACTCTGGAGGGGG + Intergenic
950975483 3:17238312-17238334 ATGGCTCCAGGCAGTGCAGGTGG - Exonic
952959981 3:38583079-38583101 AGGGCCCTAGACTCTGTGGGTGG - Intronic
957870840 3:86089244-86089266 GTGCCTCCAGACTCTGTGTGGGG + Intergenic
958864473 3:99485181-99485203 ATGCCTCCTGACTCTGTGGGGGG + Intergenic
960438724 3:117660427-117660449 AGGGCTCAAGCATCTGTAGGTGG + Intergenic
960659578 3:120043254-120043276 ATGGCCCATGACTCTGGAGGTGG - Intronic
960720398 3:120619530-120619552 ATGGCCCATGACTCTGGAGGGGG + Intergenic
962096786 3:132300494-132300516 ATGGCCCACGACTCTGGAGGAGG + Intergenic
962097333 3:132305978-132306000 ATGGCCCACGACTCTGGAGGGGG - Intergenic
964091991 3:152888255-152888277 GTGGCTCCACATTCTGTTGGGGG + Intergenic
964349901 3:155791944-155791966 AGGGCTCCAGAATCAGTAGGTGG - Intronic
967481600 3:189979625-189979647 ATGATTCCAGAGTCAGTAGGGGG - Intronic
968745837 4:2359683-2359705 AGGACTCCAGACTCGGTAGCCGG - Intronic
969050672 4:4370758-4370780 TTGGCTACAAAGTCTGTAGGTGG + Intronic
969549242 4:7853394-7853416 GTGGCCCCAGACTCTGCAGGTGG + Intronic
970214896 4:13748542-13748564 AAGTCTCCAGAACCTGTAGGTGG - Intergenic
973296544 4:48529180-48529202 ATGACTCCAGACTTTTAAGGAGG + Intronic
973880222 4:55263933-55263955 CTTGCTCCAGACGATGTAGGTGG - Intergenic
977969949 4:103201507-103201529 ATGGCTCCAGAGTCTGCACCTGG - Intergenic
981852269 4:149244707-149244729 CTGGGTCTAGAATCTGTAGGGGG + Intergenic
982082297 4:151802229-151802251 ACGGCTACAACCTCTGTAGGTGG - Intergenic
984235724 4:177155820-177155842 AAGTCTCCAGAATCTCTAGGTGG + Intergenic
986524334 5:8656810-8656832 ATGCCTCCAGTCTCTATAGTTGG - Intergenic
986767091 5:10938066-10938088 ATGGCTCCAGATTTTGTGGTAGG + Intergenic
987930577 5:24395251-24395273 ATGGCCCATGACTCTGGAGGTGG + Intergenic
989096082 5:37782505-37782527 ATGGCCCATGACTCTGGAGGGGG + Intergenic
990595139 5:57305414-57305436 ATGGCTCCTGCCTCTGTTGCAGG + Intergenic
992192084 5:74303057-74303079 ATGGGTCCAGATTTTGTGGGAGG - Intergenic
992703818 5:79367882-79367904 ATGGATTCAGAGTCTATAGGTGG - Intergenic
998399703 5:141842187-141842209 ACAGGTCAAGACTCTGTAGGAGG - Intergenic
998552525 5:143091142-143091164 ATGGCCCACGACTCTGGAGGGGG + Intronic
1000236787 5:159369439-159369461 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1001558481 5:172652910-172652932 ATGGCCCACGACTCTGGAGGGGG + Intronic
1003237074 6:4304414-4304436 CTGGCACCCAACTCTGTAGGTGG - Intergenic
1004190180 6:13456891-13456913 AGGGCACCACAGTCTGTAGGAGG - Intronic
1004416210 6:15426511-15426533 CTGTCTCCACACTATGTAGGAGG + Intronic
1005461894 6:26077317-26077339 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1005987448 6:30883813-30883835 AAGGCCCCAGACCCTGAAGGCGG - Intronic
1010470620 6:76223504-76223526 ATGGCACCACACTATGTAGCTGG - Intergenic
1013498036 6:110718358-110718380 AGGGCTCTGGACTCTGCAGGAGG - Intronic
1015049507 6:128822555-128822577 ATGGCTCCAGATGCTTTGGGAGG + Intergenic
1015171887 6:130263523-130263545 ATGGCCCACGACTCTGGAGGGGG - Intronic
1016388671 6:143553493-143553515 CTGTCTCCAGCCTCTGTGGGAGG - Intronic
1017711290 6:157170605-157170627 ATGGCTCCAGACTCTGTAGGTGG + Intronic
1020655739 7:10926470-10926492 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1021905756 7:25331443-25331465 CTTGCTCCAGGCTCTGTACGCGG - Intergenic
1023436382 7:40144410-40144432 ATGGCCCATGACTCTGGAGGGGG + Intronic
1023955903 7:44886182-44886204 GTGGCTCCAGACTCTGGGGTAGG - Intergenic
1026530546 7:71193576-71193598 TTGTCTCCAGGCTCTGAAGGAGG - Intronic
1028333938 7:89628430-89628452 ATGGCCCACGACTCTGGAGGGGG - Intergenic
1029155961 7:98518294-98518316 ATGCCCCCAGTCTCTGTGGGAGG + Intergenic
1032268671 7:130385136-130385158 CTGGCTCCGGACACTGTGGGGGG - Exonic
1032467387 7:132154676-132154698 ATGGCTCCAGACAGTGTGGTGGG + Intronic
1033658408 7:143388239-143388261 AGGGCCCCTGACTCTGAAGGAGG + Exonic
1039261477 8:35776570-35776592 ATGGCCCCAGACACAGAAGGGGG - Intronic
1039876812 8:41593553-41593575 ATGGCCCACGACTCTGGAGGAGG + Intronic
1040470405 8:47731603-47731625 CTGGCTCCCAACTCTGCAGGTGG - Intronic
1041515427 8:58694420-58694442 ATGGCCCAGGACTCTGGAGGGGG - Intergenic
1049425538 8:142536417-142536439 ACGGCAGCAGACTCTGTAGGAGG - Intronic
1050487398 9:6148616-6148638 ATGGCTCTAGCATCTGTTGGGGG - Intergenic
1050906830 9:11015670-11015692 AGGGCTCCACAATCAGTAGGTGG + Intergenic
1052677253 9:31643116-31643138 ATGTTTCCAGAATATGTAGGTGG - Intergenic
1053365471 9:37519533-37519555 ATGGCTCCAGACACTGCTGCAGG - Intronic
1056589946 9:87958835-87958857 TTGGCTCCTGTCACTGTAGGGGG + Intergenic
1059344037 9:113616270-113616292 CAGGCTCCAGGCTCTGGAGGAGG + Intergenic
1061930851 9:133832374-133832396 GTGGCTGCAGACTCTGCTGGGGG + Intronic
1186600902 X:11036085-11036107 GTGGCTCCAGAGTCTGTATTTGG + Intergenic
1190523093 X:51299662-51299684 ATGGCTCTACAGTCAGTAGGTGG - Intergenic
1190771180 X:53516021-53516043 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1196460027 X:115920115-115920137 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1196869367 X:120098343-120098365 ATGGCCCATGACTCTGGAGGGGG - Intergenic
1197887621 X:131234984-131235006 GTGGCTCCAGAGTCTCTAGAGGG - Intergenic
1198263944 X:134992077-134992099 ATGGATCAAGACTCTGGAGTCGG + Exonic
1202192586 Y:22260077-22260099 ATGCCTCCAGACTTTGTTGAAGG + Intergenic