ID: 1017712195

View in Genome Browser
Species Human (GRCh38)
Location 6:157180932-157180954
Sequence CAGCATGTGGAGGTGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 662}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017712195_1017712205 18 Left 1017712195 6:157180932-157180954 CCATGCCCCACCTCCACATGCTG 0: 1
1: 1
2: 6
3: 65
4: 662
Right 1017712205 6:157180973-157180995 CCAGCTCCTCCACCACTACTGGG 0: 1
1: 0
2: 1
3: 20
4: 468
1017712195_1017712203 17 Left 1017712195 6:157180932-157180954 CCATGCCCCACCTCCACATGCTG 0: 1
1: 1
2: 6
3: 65
4: 662
Right 1017712203 6:157180972-157180994 TCCAGCTCCTCCACCACTACTGG 0: 1
1: 0
2: 0
3: 17
4: 279
1017712195_1017712206 19 Left 1017712195 6:157180932-157180954 CCATGCCCCACCTCCACATGCTG 0: 1
1: 1
2: 6
3: 65
4: 662
Right 1017712206 6:157180974-157180996 CAGCTCCTCCACCACTACTGGGG 0: 1
1: 0
2: 1
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017712195 Original CRISPR CAGCATGTGGAGGTGGGGCA TGG (reversed) Intronic
900147508 1:1164875-1164897 CAGCCTGTGCAGGTGGGACCCGG + Intergenic
900168352 1:1254092-1254114 CATCGCGTCGAGGTGGGGCACGG - Intronic
900655264 1:3753783-3753805 CAGCATGTGTGGGTGGGGTCGGG + Intronic
901139535 1:7019458-7019480 CAGCTCCTGGTGGTGGGGCAGGG + Intronic
901414243 1:9105847-9105869 CTCCATGTGGAGGTGGGGACTGG - Intronic
901761252 1:11473131-11473153 CAGAGTGGGGAGGTGGGGCTGGG + Intergenic
901880811 1:12192705-12192727 GTGCATGGGGAGGTGGGGGAGGG + Intronic
902617595 1:17632304-17632326 CAACAGCTGGAGGAGGGGCAGGG - Exonic
902668059 1:17953231-17953253 AAGCAGGTGCCGGTGGGGCAGGG + Intergenic
902714861 1:18265675-18265697 AAGCATGTGGAGGTCAGGCAGGG - Intronic
903138857 1:21326645-21326667 CAGCGTAGGGAGGTGGGGCGAGG + Intronic
903228906 1:21910085-21910107 CAGATTCTGGAGGTGGGGCGGGG - Intronic
903499589 1:23793938-23793960 GAGGATGTGGAGGAGGGGCTGGG - Intronic
903575089 1:24334738-24334760 CTCCAGGTGGAGGTGGGGAAGGG - Intronic
903663533 1:24993230-24993252 CAGCAGGAGGAGGTGGAGCAGGG - Intergenic
903724347 1:25430142-25430164 CAGCCTGTGGACGTGGAGCCCGG + Intronic
904093087 1:27958777-27958799 CAGCAGCGGGAGCTGGGGCACGG - Exonic
904131768 1:28280883-28280905 CAGCGTGGGGAGGGTGGGCATGG - Exonic
904329417 1:29748313-29748335 GGGCATGTGGTGGTGGGGGAGGG - Intergenic
904442380 1:30540113-30540135 CAGCCTGAGGGGGTGGGGAATGG + Intergenic
904488903 1:30846087-30846109 CAGCACCTGGTGGTGGAGCAAGG - Intergenic
904774608 1:32899110-32899132 CGGCATGTGCAGGTAGGGCTGGG - Intronic
905543565 1:38779718-38779740 CAGCAAGTGGAGAAAGGGCAGGG - Intergenic
905583555 1:39100291-39100313 CAGTAGGTGGAGTTGGGGGATGG + Intronic
905632335 1:39525562-39525584 GAGCAGGTGGAGCTGGGGCGGGG + Intronic
905642206 1:39598210-39598232 CTGAGTGTGGAGGTGGGGGAGGG - Intergenic
905859894 1:41343179-41343201 GAGCATGAGGAGGTTGGGGAAGG - Intergenic
906490782 1:46266838-46266860 AAGGCTCTGGAGGTGGGGCAGGG + Intronic
906744617 1:48213043-48213065 CAGCCTGGGGAGGTGGGGAGAGG + Intergenic
906902394 1:49849280-49849302 CAGGATGTGGATGTGTGGGAAGG + Intronic
907521166 1:55024258-55024280 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
908472184 1:64455208-64455230 AAGAATTTGGTGGTGGGGCATGG - Intergenic
908755873 1:67468357-67468379 CAGCATGTAGGGGTGAGGGAAGG + Intergenic
909038514 1:70622684-70622706 GAGCATGTGGAGGCTGGGGATGG + Intergenic
910667614 1:89741735-89741757 CAGGAAGTTGAGGTGGGGAATGG + Intronic
911570012 1:99509617-99509639 CATCAGGTTAAGGTGGGGCAGGG - Intergenic
911978970 1:104541863-104541885 CAGCAAGTGGTGGTGGGAAATGG - Intergenic
913275993 1:117138192-117138214 CAGCATGTAGAGATGGCGGAAGG - Intergenic
913283023 1:117203333-117203355 CACAATGAGGAGGTGAGGCAGGG + Intronic
914797237 1:150930678-150930700 CTGGGTGTGGTGGTGGGGCAGGG - Intronic
914801170 1:150963750-150963772 CAGCATCTAGAGGTGGGGAGAGG - Intronic
915070927 1:153266230-153266252 CAGGAGCTGGAGGTGGGGAAGGG - Intergenic
915485878 1:156220252-156220274 CAGCATGGGCAGGCCGGGCATGG - Intronic
915557681 1:156669491-156669513 CAGTCTGAGGAAGTGGGGCAAGG - Exonic
917034012 1:170726423-170726445 AAACATGTGGAAGTGGAGCAAGG - Intronic
918189699 1:182162385-182162407 CAGCATGTGGAGGTAGGCCCAGG + Intergenic
919737231 1:200960291-200960313 CAGCATGAGGAGCTGGGGAGTGG - Intergenic
919845633 1:201640421-201640443 CAGCAAGTGGGAGTGGGGGATGG + Intronic
920234635 1:204494589-204494611 CAGCTTGTGGGGGTGGGGAGGGG + Intronic
920313175 1:205060417-205060439 AAGCATGTGGAAGTGGGGCCAGG + Intronic
920360257 1:205410585-205410607 AGGCATTTGGGGGTGGGGCAGGG - Intronic
920445016 1:206009742-206009764 CAGCATGTGGAGCTGGAGAGAGG + Exonic
920520778 1:206623957-206623979 CAGCATGGGGTGGTGGGGGGGGG - Intergenic
920740487 1:208577104-208577126 CAGCATTTGGAGGAGCGGAAGGG + Intergenic
920822892 1:209398021-209398043 TAGGATGTGGAGGTGAGGAAAGG - Intergenic
920836241 1:209513695-209513717 CAGGATGTGGAATAGGGGCACGG - Intergenic
921156823 1:212445550-212445572 GAGCATGCTGGGGTGGGGCAGGG - Intronic
921573230 1:216803398-216803420 CAGCATTTGGTGATGGGGCGGGG - Intronic
922247727 1:223817193-223817215 CTGCATGTGGAGGAGGGGGAGGG + Intronic
922706383 1:227792906-227792928 CAGCATCTGGTGGAGGGGCAGGG + Intergenic
923263107 1:232286059-232286081 CAGCATGAGGAGATGGGTAATGG - Intergenic
923648229 1:235845866-235845888 CATCAGGTGGGGGTGGGGCTAGG - Intronic
924004029 1:239587172-239587194 CAGCACGTGGAGGTGAGGCCAGG - Intronic
924772355 1:247088815-247088837 CAGCTTGTGGAGTTGGGGTTGGG - Intergenic
924802288 1:247336263-247336285 TAGCATGTGGAGTGGGGGGAGGG - Intergenic
1062934273 10:1374572-1374594 GAGCATGTGCGGGTGGGGCCAGG + Intronic
1062950857 10:1502199-1502221 CAGCAGGTGCAGGAGGGGCCGGG - Intronic
1063239471 10:4153305-4153327 GAGCAAGTGGAGGCTGGGCACGG + Intergenic
1063360275 10:5448852-5448874 CAGCATTTGGAGGTGATGAAGGG - Intronic
1063624834 10:7679299-7679321 GTCTATGTGGAGGTGGGGCAGGG + Intergenic
1064166858 10:12994105-12994127 CAGCATCTAGAGGTGGGGCATGG + Intronic
1065178060 10:23097547-23097569 TGGAATGTGGAGGTGGGGCTTGG - Intronic
1065528496 10:26645946-26645968 CAGGATATGGGGGTGAGGCAGGG + Intergenic
1065622228 10:27594053-27594075 TACCAAGTGGAGATGGGGCAAGG + Intergenic
1066658997 10:37721262-37721284 GGAGATGTGGAGGTGGGGCATGG - Intergenic
1067201278 10:44174017-44174039 CAGCAAGTGGGGGCTGGGCAGGG + Intergenic
1067337821 10:45378973-45378995 CTGCAGGTGTAGGTAGGGCAGGG + Intronic
1067733430 10:48830468-48830490 AAGCAGGTGGAGGTGGAGAAAGG + Intronic
1067819783 10:49518564-49518586 CATCAAGTGGAGGTGGGGGCAGG - Intronic
1067947785 10:50701310-50701332 AGGCATGGGGAGGAGGGGCAGGG + Intergenic
1068434463 10:56973022-56973044 CCCCATTTGGAGGTGGGGCTTGG - Intergenic
1068630280 10:59290855-59290877 CAGTATTTGCAGGGGGGGCAGGG + Intronic
1069226320 10:65949578-65949600 AAGCATGGGGAGGTAGGGCCTGG + Intronic
1069693658 10:70371550-70371572 CAGCCTGTGGTTGTGGGGCCAGG - Intronic
1070310179 10:75267297-75267319 GAGCATGGGGAGGTGGTGCTGGG + Intergenic
1070773501 10:79096562-79096584 CAGCACGTGGAGGTGAGGGGTGG + Intronic
1070789000 10:79178686-79178708 AAGCATGCGGGGGTGGGGGAGGG - Intronic
1070793154 10:79201687-79201709 AAGCAGGTGGGTGTGGGGCAAGG + Exonic
1070883102 10:79866303-79866325 AGGCATGGGGAGGAGGGGCAGGG + Intergenic
1071649670 10:87382618-87382640 AGGCATGGGGAGGAGGGGCAGGG + Intergenic
1072041248 10:91608835-91608857 GAGGGAGTGGAGGTGGGGCAGGG + Intergenic
1072310011 10:94145667-94145689 CACCACCTGGAGGTGGGGCCAGG - Intronic
1072356244 10:94614532-94614554 CTGAAGCTGGAGGTGGGGCAGGG - Intergenic
1072460118 10:95611055-95611077 CAGCTGGAGGAGGAGGGGCAGGG - Intronic
1072570572 10:96654536-96654558 CAGAAGGTGTAGGTGGGACAAGG - Intronic
1072625332 10:97107723-97107745 CAGCACGTGGGGGTGGGGCAGGG - Intronic
1073660259 10:105467932-105467954 CAGAATGTGGAGTTTGGGCTTGG + Intergenic
1074006585 10:109431447-109431469 CAGCATGTGGGGGCAGGGAACGG + Intergenic
1074102505 10:110364757-110364779 CAGCAGGTGGGGGTGGGGGCAGG - Intergenic
1074508798 10:114094828-114094850 CCTCATGTGCGGGTGGGGCAAGG - Intergenic
1074867585 10:117553861-117553883 CTGCAGGTGGAGGTGGGGGCAGG - Intergenic
1075069297 10:119309974-119309996 GAGACTGTGGAGGTGGAGCATGG + Intronic
1075466939 10:122658614-122658636 CAGCATGGGGAGGTCTGGAAAGG + Intergenic
1075469830 10:122679811-122679833 CAGCATGGGGAGGTCTGGAAAGG + Intergenic
1075579002 10:123602740-123602762 CAGGATGCTAAGGTGGGGCAAGG + Intergenic
1075610044 10:123846117-123846139 CACCATCTGGGGGTGGGGGATGG + Intronic
1076043353 10:127270167-127270189 GAGCCTGTGGAGGTGCGGCCAGG - Intronic
1076552829 10:131294987-131295009 CAGGAGGTGGGGGTGGGACAAGG - Intronic
1077472792 11:2772094-2772116 CAGCATGGAGGGGTGGGGCCAGG + Intronic
1077534112 11:3111141-3111163 CAGGGGGTGGGGGTGGGGCACGG - Intronic
1077913294 11:6593184-6593206 CAGAATGTGGGGGTGGGGGTGGG - Intronic
1078229510 11:9426905-9426927 CAGCATATGGCGGGGGGGCGGGG - Intronic
1078428979 11:11272735-11272757 GTGGAAGTGGAGGTGGGGCATGG - Intronic
1078598181 11:12707272-12707294 CAGCATGAGGAGGAGTGGAAGGG - Intronic
1078823735 11:14907028-14907050 CAACATGTGGAGCTGGGGGTGGG - Intronic
1080392850 11:31864471-31864493 AACTATGTGGGGGTGGGGCAGGG + Intronic
1080878992 11:36301582-36301604 CAGCTGGAGGAAGTGGGGCATGG + Intronic
1081042018 11:38224783-38224805 GAGCATAAGGAGGTGGGGCCAGG - Intergenic
1082034528 11:47633966-47633988 CAGCATATGGGGGTGGGAAATGG + Intronic
1082567673 11:54700273-54700295 CATCATTTGGGGGTGGGGCTAGG + Intergenic
1082833074 11:57633818-57633840 AAGAATGTGGAGGTGGGGTAGGG + Intergenic
1082853155 11:57783314-57783336 CATCAAGTGGAGGTAGGGCGGGG + Intronic
1084087397 11:66860845-66860867 CAACAGGAGGAGGTGGGGGACGG + Intronic
1084394254 11:68898484-68898506 GAGGAGGTGGAGGTGGAGCAGGG - Intronic
1084677670 11:70645734-70645756 CAGACTGGGGAGCTGGGGCAAGG + Intronic
1084800893 11:71543188-71543210 CTGCAGGTGGAGGAGGGCCAGGG + Intronic
1085041749 11:73330926-73330948 CAGCAGGTGGGGGTGGGGGCAGG + Intronic
1085264042 11:75225899-75225921 GAGCAGGAGGGGGTGGGGCATGG - Intergenic
1085428209 11:76423521-76423543 CAGGATGTGAGGGTGGGGCAAGG + Intergenic
1085833055 11:79922471-79922493 CAACATGTAGAGGTGGGAGATGG + Intergenic
1085896383 11:80644540-80644562 CAGCATCCTGAGGTGGCGCAGGG - Intergenic
1085982161 11:81737724-81737746 CAAAATGTTAAGGTGGGGCAGGG + Intergenic
1086559338 11:88149082-88149104 CAGGAGGTGGAGCTGAGGCAGGG - Intronic
1087024018 11:93632102-93632124 CAGCATGTGCAGGTGGGGCCTGG - Intergenic
1087144655 11:94799818-94799840 CAGCAGGGGGCGGTGGGCCATGG + Exonic
1087732698 11:101796849-101796871 CAGTGGGTGGAGGTGGGGCCTGG + Intronic
1088569729 11:111211941-111211963 CGACTTGTGGAGGTGGAGCAAGG + Intergenic
1088580307 11:111309263-111309285 CCTCATCTGGAGGTGAGGCAGGG - Intergenic
1089107392 11:116024164-116024186 CATCAGGTGGGGGTGGGGCTAGG - Intergenic
1089321294 11:117628404-117628426 CTGCACGAGGAGGTCGGGCAGGG - Intronic
1089729231 11:120510491-120510513 CAGTGTGTGGAGCTGGGGGAGGG + Intergenic
1090198723 11:124839260-124839282 CAGCCCGGGGAGGTGGGGGAGGG - Intergenic
1090804868 11:130196553-130196575 CAGTATCTGGAGGGGGGGCGGGG - Exonic
1090901727 11:131038025-131038047 CTGCAGGTGGAGTTGGGGGAGGG - Intergenic
1091074925 11:132606560-132606582 CAGAAAGTGGAGGTGGGAGACGG - Intronic
1091223744 11:133945866-133945888 AGGGCTGTGGAGGTGGGGCAGGG - Intronic
1091397650 12:163501-163523 CACCAGGCGGCGGTGGGGCACGG - Exonic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1093096367 12:14976267-14976289 CAGCATGAGCAGGTGGTCCAGGG + Intronic
1093389599 12:18602408-18602430 CATCAGGTGGGGGTGGGGCTAGG - Intronic
1093720574 12:22437477-22437499 CAGCAGGTGGGGGTGGGGCTAGG - Intergenic
1096004519 12:48158148-48158170 CAGCACATGGTGGTGGTGCATGG + Intronic
1096347885 12:50866508-50866530 CATCAGGTGGGGGTGGGGCTAGG - Intronic
1096405581 12:51341760-51341782 TAGCATGTGCAGGTGGGGGTGGG - Intronic
1096497644 12:52047642-52047664 CAGCTTGGGGAGGTGGGGCCTGG + Intronic
1096673425 12:53213695-53213717 CAGCATCTGGAGGTGGGGGGTGG + Exonic
1096933335 12:55241307-55241329 TAGAATTTGGAGGTGGAGCAGGG + Intergenic
1097161347 12:57048564-57048586 CAGTTGGTGGGGGTGGGGCAGGG + Intronic
1097250177 12:57628084-57628106 CAGGATGTGGGGGTGGAGAAGGG - Intronic
1097697800 12:62791272-62791294 GAGGATGAGGAGGAGGGGCACGG + Intronic
1098797152 12:74904011-74904033 CAGGAGGTGGTGGTTGGGCATGG - Intergenic
1098919807 12:76293088-76293110 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1100297823 12:93278970-93278992 CAGTAAGGGGAGGTGGGGCCAGG + Intergenic
1100799190 12:98213447-98213469 AAGTATGTGGAGGTGGGGTCAGG + Intergenic
1100806653 12:98292538-98292560 CAGCACATGGAAGTGGGTCAGGG - Intergenic
1101443322 12:104719710-104719732 CAGAATGAGGAGTTGGGGCATGG + Intronic
1101489515 12:105198191-105198213 CAGCATGTGGCTGTGGTGCGGGG - Intronic
1101633922 12:106521567-106521589 CAGCATGTGGGGAATGGGCACGG + Intronic
1101719670 12:107340546-107340568 CAGAATCTGGAGGTGGGGAAGGG + Intronic
1101857134 12:108453149-108453171 CAGGATGGGGAGGTGTGGAATGG - Intergenic
1102045493 12:109827491-109827513 CAGCAGGTGAGGGTGGGACAGGG - Intronic
1102797985 12:115705963-115705985 CTGCATGTGCATGTTGGGCAAGG - Intergenic
1103204425 12:119117357-119117379 CAACATGGAGAGATGGGGCAGGG - Intronic
1103963202 12:124622176-124622198 GAGAATGGGGAGGTGTGGCAGGG + Intergenic
1104837331 12:131800051-131800073 CAGCATGGTGAGGCGGGGCTGGG - Intergenic
1104968655 12:132521245-132521267 CAGGCTGTGGGGCTGGGGCAGGG + Intronic
1104974194 12:132545063-132545085 CAGCATGGGGCCGTGCGGCACGG + Intronic
1105647509 13:22337523-22337545 CAGATTTTGGAGGTGGGGCCTGG + Intergenic
1106292079 13:28373164-28373186 CACCGTGTGGAGGTGGGGGAGGG + Intronic
1106861206 13:33910873-33910895 GAGCAGGAGGAAGTGGGGCAGGG + Intronic
1107179985 13:37447639-37447661 GTGCATGAGGAGGTGGGGCAAGG + Intergenic
1108590452 13:51908297-51908319 CAGAATGTGGGGGTGGGGGTGGG + Intergenic
1108848263 13:54700348-54700370 CAGGAAGTGGTGGTGGGGCTGGG - Intergenic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1108970055 13:56362843-56362865 TCCTATGTGGAGGTGGGGCATGG - Intergenic
1109934695 13:69265431-69265453 AAGCATGTGGGGGTCGGGCAGGG + Intergenic
1110302703 13:73948127-73948149 CATAATGTAGATGTGGGGCAGGG - Intronic
1110810557 13:79807496-79807518 CAGCCTGTGGAGATGGGGGTAGG - Intergenic
1111524325 13:89448725-89448747 CAGCATGGGCAGGTTGGGCATGG - Intergenic
1111849264 13:93551675-93551697 AAGGAAGTGGAGGTGGGGAAAGG + Intronic
1112146262 13:96703918-96703940 CAGCTTGTGGGGGTGGGGAGAGG - Intronic
1112429911 13:99342359-99342381 CAGCGTGTGAATTTGGGGCAGGG + Intronic
1113616023 13:111681209-111681231 CAGCATGTTGAGGAGGTGCAGGG - Intergenic
1113621491 13:111766102-111766124 CAGCATGTTGAGGAGGTGCAGGG - Intergenic
1114210163 14:20607251-20607273 GAGTAGGTGGACGTGGGGCAGGG - Intronic
1114265703 14:21071406-21071428 CAGGGAGTGGAGGAGGGGCAGGG + Intronic
1114635451 14:24184446-24184468 CAGGAGGTGGAGGTGGGCTACGG + Intronic
1115695865 14:35898084-35898106 CAGTATGTGGAGGTAGGGAGGGG + Intronic
1116438036 14:44915839-44915861 TGGCATTAGGAGGTGGGGCAAGG + Intergenic
1117510785 14:56448752-56448774 CATCAGGTGGGGGTGGGGCTAGG + Intergenic
1117534442 14:56690246-56690268 CAGCAAGTGGAGGCTGAGCAGGG + Intronic
1118692437 14:68352884-68352906 CAGCAGGTGGGGGTCTGGCACGG + Intronic
1118708867 14:68503421-68503443 CAGCCTCTGGAGGAGGGGGAAGG - Intronic
1118779024 14:68993771-68993793 CAGCTGGTGGAGGTGGGGTGGGG + Intergenic
1118918878 14:70131891-70131913 AAGGAAGTGGAGGTGGGTCAAGG + Intronic
1118937389 14:70300245-70300267 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1119317108 14:73705150-73705172 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1119628915 14:76208925-76208947 CAGCATGGGGAGGTGGGGATGGG + Exonic
1119783578 14:77295952-77295974 CACCATGGAGAGGTGGGACATGG + Intronic
1121083844 14:91129935-91129957 CATCATGTTGAGGCTGGGCACGG - Intronic
1121581763 14:95037237-95037259 TACCATGGGGAGTTGGGGCAGGG - Intergenic
1121615627 14:95311745-95311767 GAGCATGTGGTGGGGGGCCATGG - Intronic
1121766751 14:96494480-96494502 GAGGATGTGGAGGTGTGGGAAGG - Intergenic
1122425837 14:101604799-101604821 CAGCATGAGGATGAGGGGCAGGG + Intergenic
1122801412 14:104231566-104231588 CAGCACTTGGTGGTGGGGCCTGG + Intergenic
1122872065 14:104643370-104643392 TAGCAGGTGGGGGAGGGGCACGG - Intergenic
1123021367 14:105399269-105399291 GAGCAGGGGGAGGTGGGGCGGGG - Intronic
1123036862 14:105475123-105475145 CGGCTTGTGGGGGCGGGGCAGGG + Intronic
1123680485 15:22759520-22759542 CAGCATCTGGAGGTCCGGAAAGG - Intergenic
1124647486 15:31449141-31449163 CACCTTGTGGGGCTGGGGCAAGG - Intergenic
1125033584 15:35097498-35097520 CAGCATGTGCATTTGGGACAGGG - Intergenic
1125274832 15:37979044-37979066 GATCATGGGGAGGTGGGGCCTGG - Intergenic
1126204996 15:46035435-46035457 CAACATATGGAACTGGGGCAGGG - Intergenic
1126460787 15:48913208-48913230 CATCAGGTGGGGGTGGGGCTAGG + Intronic
1126680996 15:51202084-51202106 CAGCAGGTCCAGGTGGGGCCTGG + Intergenic
1126843655 15:52740246-52740268 CAGCCTGGGGAGGTGGGGAGAGG - Intergenic
1127346819 15:58109354-58109376 CAGCATGGGGATGTAGGACAGGG + Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1128237681 15:66079025-66079047 CAGGAGGTGGGGGTGAGGCAGGG - Intronic
1128370126 15:67034173-67034195 GTGCATGTGGAGCTGGGGAAAGG + Intergenic
1128638396 15:69317779-69317801 CAGCATGGGGAGAAGGGGAAAGG - Intronic
1128799357 15:70487759-70487781 CAGTGAGTAGAGGTGGGGCAGGG - Intergenic
1129062864 15:72874157-72874179 GAGCTTGTGGAGGCTGGGCAGGG + Intergenic
1129676817 15:77636214-77636236 CAGGAGGTGGAGCTGGGGCAAGG + Intronic
1130056247 15:80528517-80528539 CAACATGAGGTTGTGGGGCAGGG - Intronic
1130096897 15:80862690-80862712 CAGCAGGTGGATGAGGAGCAGGG + Intronic
1130272419 15:82458926-82458948 CAACCCATGGAGGTGGGGCATGG + Intergenic
1130459871 15:84152898-84152920 GGGCAGGTGGAGGTGGCGCAGGG - Intergenic
1130464770 15:84186279-84186301 CAACCCATGGAGGTGGGGCATGG + Intergenic
1130487915 15:84408525-84408547 CAACCCATGGAGGTGGGGCATGG - Intergenic
1130499496 15:84487258-84487280 CAACCCATGGAGGTGGGGCATGG - Intergenic
1130587062 15:85190893-85190915 CAACCCATGGAGGTGGGGCATGG + Intergenic
1131265395 15:90912430-90912452 CAGCATGGGGAAGCAGGGCACGG + Intronic
1132283521 15:100641940-100641962 CTGCAAGTGGTGGTGGGGCCAGG + Intronic
1132536317 16:482845-482867 CATTATGTGGGGGTGGGGCTTGG + Intronic
1132792458 16:1699266-1699288 GAGGGTGGGGAGGTGGGGCAGGG + Exonic
1132804469 16:1769219-1769241 CAGCATGCAGAGGTGGGCCCAGG - Exonic
1133019467 16:2960827-2960849 CAGAGTGTGGAGGTGAGGCCTGG + Intergenic
1133233292 16:4376388-4376410 CAGCATGAGGAGCGGGGGCCCGG + Intronic
1133296416 16:4754826-4754848 CCCAATGTGGAGGTGGGGCCTGG + Intronic
1133873964 16:9715609-9715631 AAACATTTGGAGGTGGGGCCTGG + Intergenic
1133984800 16:10660373-10660395 CAGCAGGTGGGGGTGGGGTGGGG - Intronic
1134761856 16:16721514-16721536 CCTCATAAGGAGGTGGGGCATGG - Intergenic
1135948824 16:26892783-26892805 AAGCATGTGGTGGTGGGACTTGG - Intergenic
1136372124 16:29843014-29843036 CAGCCTGTGGACCTGGGGAAGGG + Intronic
1136523529 16:30813349-30813371 CAGAAAGTGAAGGTGGGGCTGGG + Intergenic
1136573615 16:31110630-31110652 CAGCATCTTGGGGTGGGGCTAGG + Intronic
1136774001 16:32861492-32861514 AAGCATGTGGAGGCTGGGCGTGG - Intergenic
1136896608 16:34000027-34000049 AAGCATGTGGAGGCTGGGCGTGG + Intergenic
1137591170 16:49694793-49694815 CAGCATCTTGAGGTAGGGTAGGG + Intronic
1138438872 16:57022490-57022512 CTGCAGGAGGAGGTGGGGCTGGG - Intronic
1139971376 16:70777690-70777712 GAAGATGCGGAGGTGGGGCAGGG + Intronic
1141067771 16:80927707-80927729 ATGCATGTGGAGGTGAGGAAGGG + Intergenic
1141395753 16:83702920-83702942 ATGCATGTGGAGGTGGGGCAGGG + Intronic
1141461162 16:84179559-84179581 CAGCATCTGGCGGTGGGTGAAGG + Exonic
1141665494 16:85463279-85463301 CAGCATGAGGAGGCGGCGCTGGG - Intergenic
1141863597 16:86734638-86734660 CAGCCAGTGGGGGTGGGGGAGGG - Intergenic
1141865300 16:86746075-86746097 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1141927595 16:87179338-87179360 CTGTTTGTGGGGGTGGGGCAGGG - Intronic
1141990946 16:87609216-87609238 CAGCTTGTGGAGGTGGGTTTGGG + Intronic
1142194844 16:88734620-88734642 CAGGCTGGGGCGGTGGGGCAGGG - Intronic
1142231094 16:88900643-88900665 CTGCATGTGGAGGTGGTACATGG + Intronic
1142411604 16:89919869-89919891 CAGCATGTGGACGTACAGCACGG - Exonic
1203076423 16_KI270728v1_random:1123603-1123625 AAGCATGTGGAGGCTGGGCGTGG - Intergenic
1142679133 17:1535366-1535388 CTCCCTGTGGAGGAGGGGCATGG - Intronic
1142748733 17:1974706-1974728 CAGCCTGTGGGGGTGGGGAGGGG + Intronic
1143017308 17:3897876-3897898 CAGCCTGTGTACGTGGTGCAAGG + Exonic
1143089388 17:4439937-4439959 GAGCAGGGGGAGGTGGGGCTGGG + Intronic
1143137377 17:4719415-4719437 CACCATGTGAGGGTGGGGCTGGG + Exonic
1143410197 17:6704053-6704075 CAGCCTGCAGAGGAGGGGCAGGG + Exonic
1144998702 17:19288640-19288662 CAGTATGTGGGGGTGGAGCGTGG + Intronic
1145274250 17:21420602-21420624 CAGAATGTGGAGCAGGGGCTTGG + Intergenic
1145921578 17:28613968-28613990 CCCAATGTGGGGGTGGGGCAGGG - Intronic
1145974957 17:28978560-28978582 CAGCATGTGCAGCTGGGACTTGG + Intronic
1146000609 17:29128184-29128206 GAGCAGGGGGAGGTGGGGGAGGG + Intronic
1146007725 17:29171602-29171624 CAGCTTGATGAGGTTGGGCAAGG + Intronic
1146500044 17:33356399-33356421 CAGAATCTGGAGGTGGTTCAGGG - Intronic
1146597336 17:34181588-34181610 GAGGCTGTGCAGGTGGGGCAGGG + Intergenic
1146661168 17:34666009-34666031 CCGCAGGAGGAGGTGGGGCCTGG + Intergenic
1147321508 17:39648976-39648998 CAGCACCTGGAAGTGAGGCAAGG + Intronic
1147335624 17:39725494-39725516 CAGCATGTGAAGGGAGGGAAGGG + Intronic
1147702843 17:42406723-42406745 AAGAAGGTGGAGGTGGGGGAGGG - Intronic
1147926031 17:43946465-43946487 CAGGATGCGGGGGTGGGGCGGGG - Intergenic
1148453080 17:47793525-47793547 CAGCAACTGGAGGTGGGGAAGGG + Intergenic
1148603480 17:48910777-48910799 CACCAAGAGGAGGTGGGGGAAGG - Intronic
1149347009 17:55749107-55749129 CTGCATGGGGAGGTGGGGAGAGG + Intergenic
1151462253 17:74261448-74261470 CAGGTGGTGGGGGTGGGGCAGGG - Exonic
1151960675 17:77403930-77403952 CAGCAGCTGGGGGAGGGGCATGG - Intronic
1152167128 17:78717076-78717098 CAGCACGTGGCAGTGGGGGAGGG - Intronic
1152302132 17:79501299-79501321 GGACATGTGGAGGTGTGGCAGGG - Intronic
1152323484 17:79622389-79622411 CAGCCAGAGGAGGTGGGGCTGGG + Intergenic
1152375282 17:79915692-79915714 CAGGAGGAGGAGGTGGGGCCAGG + Intergenic
1152508500 17:80769713-80769735 CAGCAAGAGGAGGTGGAGAAAGG + Intronic
1152573173 17:81129263-81129285 GAGAATGTAGAGGCGGGGCAGGG + Intronic
1152861917 17:82701332-82701354 CAGAAGGTGGAGGTGAGGCCGGG + Intergenic
1153823676 18:8855423-8855445 CAGCAGGTGGCGGAGGGGTAGGG - Intergenic
1154136035 18:11779079-11779101 CAGCACGTAGAGGTGAGGAAGGG + Intronic
1155941456 18:31805435-31805457 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1156473167 18:37390133-37390155 CAGCATGTGGGGAGGGGGCGTGG - Intronic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1157048004 18:44125764-44125786 GAGGAGGTGGATGTGGGGCACGG + Intergenic
1157331099 18:46704519-46704541 GAGCATGTGGAGGTGGGGCAGGG - Intronic
1157368102 18:47085044-47085066 CAGCATAGGGAGCTGGGGCCGGG - Intronic
1157539842 18:48492995-48493017 CACCATGTGGAGGAGAGGCGAGG - Intergenic
1160053308 18:75456364-75456386 CAGGCTGTGGGGGTGGGGCGTGG - Intergenic
1160072334 18:75639883-75639905 CAGCAAGGGGTGGTGGAGCACGG + Intergenic
1160731358 19:643023-643045 CAGCATGTGAGGGAGGAGCAAGG - Intronic
1160767549 19:815140-815162 CTGCATGTGGAGGTAGCTCAGGG + Intronic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161166729 19:2791732-2791754 CAGGAGGGGAAGGTGGGGCACGG - Intronic
1161633293 19:5370322-5370344 AAGGAGGTGGAGGTGGGGGAGGG - Intergenic
1161739511 19:6012001-6012023 CAGCATGAGGATGATGGGCATGG - Intronic
1162029140 19:7909885-7909907 CAGCATGGAGAGGTGAGCCAGGG + Exonic
1162185884 19:8904462-8904484 CTGCCTGTTGAGGTGGGGAATGG + Intronic
1162186256 19:8907277-8907299 TTGCATGTTGAGTTGGGGCATGG + Intronic
1163038375 19:14584785-14584807 CTGCATGTGGATGTGGGGACAGG - Intronic
1163039070 19:14589046-14589068 CTGCATGTGGATGTGGGGACAGG - Intronic
1163196858 19:15728099-15728121 CATCAGTTGGAGGTGGGGGAAGG - Exonic
1163204688 19:15794104-15794126 CATCAGCTGGAGGTGGGGGAAGG - Exonic
1163266412 19:16225053-16225075 CAGCACGAGGAGGTGAGGCTGGG + Intronic
1163900369 19:20095052-20095074 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
1164160914 19:22624856-22624878 CAGCATGTGAAAGTGGGGGTGGG - Intergenic
1164445864 19:28317090-28317112 CAGCATGTGGAGGCAGTGCTTGG - Intergenic
1164857295 19:31534970-31534992 CCGCATGTGGACATGGGGCCTGG - Intergenic
1166190313 19:41172536-41172558 TAGCATGTGGAGGTGGGGTGGGG - Intergenic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1166416987 19:42602353-42602375 CTTGATGTGGGGGTGGGGCAGGG - Intronic
1166777491 19:45322006-45322028 CGGAATGTGGGGGTGGGGCGGGG - Intronic
1166853429 19:45770983-45771005 CAGCAGGTGGCGGCGGTGCATGG + Exonic
1167213894 19:48151185-48151207 CAAAATCAGGAGGTGGGGCAGGG + Intronic
1167455538 19:49595435-49595457 CAGCAGGGGGCGGTGGGGCTGGG + Exonic
1167498439 19:49832223-49832245 CAGGGAGTGGGGGTGGGGCAGGG - Intronic
1167667582 19:50831724-50831746 CAGGTGGAGGAGGTGGGGCAGGG - Intronic
1167746056 19:51352465-51352487 TAGCATGGGGAGGGAGGGCAGGG - Intronic
1168110764 19:54190289-54190311 CGGCATGAGGGGGTGGAGCAAGG + Exonic
924963607 2:56893-56915 CAGCCTGGGGAGGTGGAGCTGGG + Intergenic
925296583 2:2781149-2781171 CAGAGTGTGAAGGTGGGGGAGGG - Intergenic
925914560 2:8595543-8595565 GAGCATTTGGAAGTGGGGCCTGG - Intergenic
926079242 2:9970653-9970675 CAGCCTGTGGAGAAGGGGAAGGG + Intronic
926111436 2:10186839-10186861 CAATCTGTGGAGGTGGGGCCTGG - Intronic
926251726 2:11158859-11158881 CAGCCTGGGGAGGTGGGGTGGGG - Intronic
926499878 2:13641140-13641162 CAGCAGGCCAAGGTGGGGCAAGG - Intergenic
927869280 2:26613477-26613499 CTGCCTGTGGAGGGAGGGCATGG - Intronic
927882064 2:26695896-26695918 CAGGATGGTCAGGTGGGGCAGGG - Intronic
928610647 2:32988707-32988729 CAGCATGTGGAAGGTGGGAAAGG - Intronic
928928475 2:36600695-36600717 CAGCCTGGGGAGGAGGGGAAAGG - Intronic
929076767 2:38084806-38084828 CAGCCTGGGGAGGTGGGGAGAGG + Intronic
929793153 2:45038486-45038508 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
929938939 2:46315719-46315741 CAGGATGTAGAGGGAGGGCAGGG + Intronic
929946375 2:46375645-46375667 GAGCTTAGGGAGGTGGGGCAGGG - Intronic
929990352 2:46781253-46781275 CAGCATGGTGACGTGGGGCTGGG + Intergenic
930312577 2:49759801-49759823 CAGGAAGTGGAGGTGAGCCAAGG + Intergenic
931295804 2:60923978-60924000 CTGCATGAGGAGGTGGGATATGG - Exonic
931525212 2:63145369-63145391 CATCAGGTGGGGGTGGGGCTAGG + Intronic
932016032 2:68027108-68027130 CAGGATCTAGAGATGGGGCAAGG - Intergenic
933945980 2:87286537-87286559 CTGCATGTGGAGTTGAGGGAGGG + Intergenic
936334233 2:111575049-111575071 CTGCATGTGGAGTTGAGGGAGGG - Intergenic
936623257 2:114121882-114121904 CAGGCTTGGGAGGTGGGGCAGGG + Intergenic
937266993 2:120623027-120623049 CAGCACCTGGAGATGGGGCAGGG + Intergenic
937363338 2:121244093-121244115 CAGGAGCTGGAGGTGGAGCAGGG - Intronic
937846547 2:126584961-126584983 CAACAAGTGGAGGTGGAGCTGGG - Intergenic
937987482 2:127644574-127644596 CAGAATGTGGAGTGGGGTCATGG - Intronic
938598253 2:132811381-132811403 CATCAAGTGGGGGTGGGGCTAGG + Intronic
938772751 2:134514155-134514177 CAACATGTGGAGGGGGGCTATGG + Intronic
939181014 2:138802827-138802849 CAGCATCTAGAGGTGGGCCTAGG - Intergenic
939846035 2:147247186-147247208 CAGGATGTGGGGTTGGGGGAGGG - Intergenic
939928856 2:148207113-148207135 AAGGATGTGCAGGAGGGGCAAGG + Intronic
940760322 2:157731633-157731655 CAGGATGGGGAGCTGGGGGAGGG + Intergenic
941456279 2:165714546-165714568 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
942036883 2:172018743-172018765 CAGCAGGTGGCGGTGGGGTGAGG - Intronic
942525588 2:176849469-176849491 GAGAGTGTGGAGGTGAGGCAGGG - Intergenic
943566698 2:189524749-189524771 CAGAATCTGGAGGTGGGGCTAGG - Intergenic
946310343 2:218879631-218879653 GACCATGTGCAGGTGGGGCCAGG + Intergenic
946329004 2:218999433-218999455 CAGAATGTGAGGGAGGGGCAAGG - Intergenic
947240887 2:227993353-227993375 AAGCAGGTGGTGGTAGGGCAGGG + Intronic
947463057 2:230319842-230319864 GAGCATGAGGAAGTGGGGCTGGG - Intergenic
948609611 2:239158568-239158590 CAGCAGGTGCAGGAGGGGCTGGG + Intronic
949037208 2:241821332-241821354 GGGAATGTGGAGGTGGGGCAGGG - Intergenic
1168773446 20:430458-430480 CAGAATGTGGATGTGGGGCTGGG - Exonic
1168848625 20:961639-961661 CAGCATCTGGAGATGGGGTGTGG + Intronic
1169260325 20:4133729-4133751 CAGGGGCTGGAGGTGGGGCAGGG + Intronic
1170231204 20:14048937-14048959 CAGCAAGTGGGAGTGGAGCAAGG + Intronic
1171092286 20:22296618-22296640 CAACATGTGGGGCTGGGGCCAGG + Intergenic
1171160301 20:22916361-22916383 CATCATGTGGGGGTGGGGCTAGG + Intergenic
1171182128 20:23098487-23098509 GAGGCGGTGGAGGTGGGGCATGG - Intergenic
1171942811 20:31348088-31348110 TAGCCTGTGGTGGTGGGGCTAGG - Intergenic
1171964304 20:31517634-31517656 GAGCAGGAGAAGGTGGGGCAGGG + Intronic
1172093752 20:32450770-32450792 CCCCATGTGTAGGGGGGGCAGGG + Intronic
1172100956 20:32483710-32483732 CAGCAGGAGGAGGTGGCGGAGGG + Intronic
1172777244 20:37414821-37414843 CAGGATGTGGAGGGGAGGGATGG - Intergenic
1172905168 20:38363908-38363930 CAGCTGCTGGAGGAGGGGCAAGG - Intronic
1173625886 20:44472687-44472709 CGGCATGTGCAGGTCGAGCACGG - Intergenic
1174200472 20:48803340-48803362 CAGCATATGCGGGTGGGGGAGGG + Intronic
1174338950 20:49884078-49884100 GCGCCTGTGGGGGTGGGGCAGGG + Intronic
1174554446 20:51383745-51383767 GTGCATGTGTGGGTGGGGCATGG + Intergenic
1174708668 20:52682844-52682866 AAGCAGTTGCAGGTGGGGCATGG + Intergenic
1174868844 20:54164728-54164750 AAGGAGGTGGAGGTGGGGTACGG - Intronic
1175069075 20:56316575-56316597 CATCAGGTGGGGGTGGGGCTAGG - Intergenic
1175361750 20:58417047-58417069 CAGGAAGTGAAGGTGGGGAAAGG - Intronic
1175440126 20:58984512-58984534 CAGGATGTGGGGGTGGGGTGAGG + Intronic
1175510359 20:59520018-59520040 CAGGATCTGGAAGTGGGACAAGG - Intergenic
1175688664 20:61049915-61049937 CAGCAGCTGGAGGTGGGGCTCGG + Intergenic
1175949964 20:62578165-62578187 CAGGCTGTGGAGTTGGGGCCGGG - Intergenic
1177035882 21:16042162-16042184 CAGCGTATGGGGATGGGGCAGGG + Intergenic
1177868518 21:26542217-26542239 CAGCATAAGAAGGTGGGGGACGG + Intronic
1177995348 21:28089907-28089929 CATCAGGTGGAGGTGGGGCTAGG + Intergenic
1178578391 21:33815406-33815428 CAGAGAGTGGAGGTGGGGGATGG + Intronic
1178585005 21:33864365-33864387 CAGCATCTGGAAGAAGGGCATGG - Intronic
1178617785 21:34148390-34148412 TAGGATATGGAGGTGGGGAAGGG + Intergenic
1179185718 21:39083860-39083882 GGGCTTGTGGGGGTGGGGCAGGG + Intergenic
1179443252 21:41410889-41410911 CAGCCAGTGGAAGTGGGGAAGGG + Intergenic
1179466651 21:41580278-41580300 CAGCAGCTGGAGGAGGGACAGGG + Intergenic
1179482039 21:41684743-41684765 CATTTTGTGGAGGTGGGGCTGGG - Intergenic
1180037591 21:45257696-45257718 CGGCACATGGGGGTGGGGCAGGG - Intergenic
1180069666 21:45430054-45430076 CAGCATGTGAAGTGGGGTCATGG + Intronic
1180560813 22:16612920-16612942 CAGCTTGGGGAGGAGGGGAAAGG - Intergenic
1180839132 22:18950604-18950626 CCACATGTGGATGGGGGGCAAGG + Intergenic
1180862553 22:19094135-19094157 AAGCATGAAAAGGTGGGGCACGG + Intronic
1180981508 22:19880168-19880190 GAGCATGTTGAGGTGAGGCCTGG - Exonic
1181126872 22:20707952-20707974 CTGCATGTGGCGGCAGGGCAGGG + Exonic
1181149119 22:20870138-20870160 AAGCAAGTAGAGGTAGGGCAGGG + Intronic
1181320077 22:21997746-21997768 CAGCATGTGGTGGTGTGACTTGG - Intergenic
1182331783 22:29556056-29556078 CAGCATGTGTGGGTGGGGCCAGG - Intronic
1182456075 22:30451258-30451280 CAAGATGAGGAGTTGGGGCAGGG + Intronic
1182923253 22:34099404-34099426 TAGAATGTGGAGGTGGGGGTAGG - Intergenic
1183295035 22:37024421-37024443 CAGCATGTGGTCGTAGGGCGAGG - Exonic
1183332785 22:37230254-37230276 CGGCAGGGGGAGGTGGGGCGGGG + Intronic
1183358252 22:37370666-37370688 CAGGAGGTGGGTGTGGGGCAGGG + Exonic
1183445011 22:37847850-37847872 CAGCATAGGGAGTTGGGGCTGGG + Intronic
1184037849 22:41926867-41926889 CAGCAGGCGGGGGCGGGGCAGGG - Intergenic
1184073662 22:42162620-42162642 TAGCAAGTGAAGGAGGGGCAAGG - Intronic
1184099883 22:42336472-42336494 TGGCATGGGGAGGTGGGGGAGGG - Intronic
1184135796 22:42549176-42549198 CAGCAAGCGGGGGTGGGGGAGGG - Intergenic
1184340809 22:43884981-43885003 CGGCAGGTGGATGTGGAGCAGGG - Intronic
1184406540 22:44303869-44303891 CAGATGGTGGAGGTGGGGCTGGG - Intronic
1184575746 22:45364267-45364289 CAGGGTGTGGTGGGGGGGCAGGG - Intronic
1184771945 22:46602313-46602335 CAGCATGTGGGTGTGGGGTCAGG - Intronic
1184891156 22:47380149-47380171 TAGATTTTGGAGGTGGGGCACGG + Intergenic
1185000518 22:48242692-48242714 CAGAATGTGGGGGTGGGGATGGG - Intergenic
949144913 3:687657-687679 CAGCAAGTGGGGGGGGGGAATGG - Intergenic
950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG + Intronic
950305272 3:11911844-11911866 CATCATGGGGTGGAGGGGCAAGG + Intergenic
952219919 3:31314807-31314829 CAGAAGGTGGAGGAGAGGCAAGG - Intergenic
952804123 3:37330648-37330670 CAGGAAGTGGAGGGTGGGCAAGG + Intronic
952895348 3:38075093-38075115 CAGCCTGAGGAGGAGGGGAAAGG + Intronic
953882733 3:46700059-46700081 CAGCATGAGGAAGTGGGGATTGG + Intergenic
954325112 3:49859290-49859312 CAGCCTGGTGAGGGGGGGCAGGG - Exonic
954440297 3:50518100-50518122 CAGAATGAGGAGGTGGGGTGTGG + Intergenic
954619467 3:51987290-51987312 CAGCCTGTGGTGTGGGGGCAGGG - Exonic
954638528 3:52084724-52084746 CAGGATGTGGATATGGGGAAGGG - Intronic
954685962 3:52370406-52370428 CGGCCTGAGGAAGTGGGGCAGGG - Intronic
954852606 3:53616330-53616352 CATTCTGTGGAGGTGGGGGAAGG + Intronic
954867760 3:53744231-53744253 CAACCTGTGGGGGTGGGGCAGGG - Intronic
955037440 3:55282916-55282938 AAGCCTGTGGAGGGGGGTCATGG - Intergenic
955413343 3:58670178-58670200 GAGCAGGGGGTGGTGGGGCAGGG - Intergenic
956074411 3:65489497-65489519 CAGAAGGGGGAGGTGAGGCAGGG + Intronic
957241014 3:77661152-77661174 CAACATATGGTGGTGGGACAGGG - Intergenic
957891547 3:86365360-86365382 CAGCATGAGGTGGTGGGGGTGGG - Intergenic
958095903 3:88943950-88943972 CAGAATGTTGAGGTAGGGCTTGG - Intergenic
958676913 3:97277036-97277058 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
959046975 3:101485136-101485158 CATCAGGTGGAGGTGGGGCTAGG - Intronic
959203178 3:103273863-103273885 AAGCATGTGGGAGTGAGGCAGGG + Intergenic
959448677 3:106471474-106471496 GAGTATGTGGAGGCTGGGCATGG - Intergenic
960149171 3:114232887-114232909 CAGCAAGTGGGGGGGGGGCAGGG - Intergenic
960506975 3:118505603-118505625 CAGAAGGTGCAGGTGGGGAATGG - Intergenic
960890244 3:122440485-122440507 CAGCATATGGAGGTGGGTGAGGG + Intronic
961348706 3:126284363-126284385 CAGAATGTGGAGGTGGAAGATGG - Intergenic
961508019 3:127384229-127384251 CAGGAGGAGGAGGTGGGGGAGGG + Intergenic
961567425 3:127773641-127773663 CAACATGTGGACTTGGGGGAGGG + Intronic
962066018 3:131981305-131981327 CATCAGGTGGGGGTGGGGCTAGG + Intronic
962343311 3:134602668-134602690 CTCTCTGTGGAGGTGGGGCAGGG + Intronic
964125550 3:153230775-153230797 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
964616589 3:158672784-158672806 CAGCAGGTGGAGGTGTGGGGAGG + Intronic
964981264 3:162684198-162684220 CACTTTGTGGAGGTGGAGCAAGG + Intergenic
965321891 3:167261443-167261465 CATCAGGTGGGGGTGGGGCTAGG + Intronic
965626410 3:170687403-170687425 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
966826760 3:183971512-183971534 CAGCATGGGGTGGTGGGGTGCGG + Intronic
966933365 3:184690224-184690246 CAGGATGTGGAGCTGAGGAACGG - Intergenic
967008363 3:185407231-185407253 CAGAAAGTGGAGGTGGGTTAAGG - Intronic
967090364 3:186129841-186129863 CTGCATGTGGAAGTGGGGGATGG - Intronic
967151999 3:186659283-186659305 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
968229554 3:196997339-196997361 CAGCATGTGAAGGTGGTGCGTGG - Intronic
968517910 4:1022605-1022627 CAGCCAGCTGAGGTGGGGCAGGG - Intronic
968673862 4:1866521-1866543 CAGCACCTGGAGTTGGGGCCTGG + Intergenic
968873260 4:3252210-3252232 CACAAGGTGGGGGTGGGGCAGGG - Intronic
968893193 4:3383314-3383336 AAGCATGTTTGGGTGGGGCATGG + Intronic
968899407 4:3423979-3424001 CAGCAGGTGCAGTGGGGGCAGGG - Intronic
969241093 4:5898234-5898256 CAGCTTTTGCAGGTGAGGCAGGG - Intronic
969452937 4:7285326-7285348 CAACATGAGGAGATGGGGCCGGG - Intronic
969627687 4:8316148-8316170 CCGCATCTGGAGGTGGGGGAGGG - Intergenic
969867264 4:10084081-10084103 CACCATGTGGAGTAGGGCCAAGG + Intronic
970346580 4:15158715-15158737 CATCAGGTGGGGGTGGGGCTAGG + Intergenic
970556852 4:17242651-17242673 CAGCATGGTGTGGTGTGGCAAGG - Intergenic
970882776 4:20951135-20951157 ATGCATGTATAGGTGGGGCAGGG - Intronic
972391433 4:38617330-38617352 CAGTGTTTGGAGGTGGGGCCTGG + Intergenic
972621197 4:40749906-40749928 CCGCGAGCGGAGGTGGGGCAGGG - Exonic
972782902 4:42301414-42301436 GAACATGTGGAGGTGGTGGAGGG - Intergenic
973973598 4:56240277-56240299 TAGCATGTGGAGGTTAGGTAGGG + Intronic
974147741 4:57967462-57967484 CACCATGTGGGGCTCGGGCATGG - Intergenic
974927327 4:68316376-68316398 GAGCTTGAGGAGGTGGAGCATGG + Exonic
975188254 4:71428740-71428762 TAGCATGTGGACATGAGGCAGGG + Intronic
976075869 4:81298423-81298445 CATGATGTGGATGTGGGGCATGG + Intergenic
976140299 4:81984584-81984606 CTGCATGTGGAGGAGGAACAAGG + Intronic
977041930 4:92027501-92027523 CAGCTTGGGGAGGAGGGGAAAGG - Intergenic
977712417 4:100142857-100142879 GAGCATCTGGAGGTGGGACCTGG - Intergenic
979598161 4:122557082-122557104 CATGTAGTGGAGGTGGGGCACGG + Intergenic
980039288 4:127920792-127920814 CAGCATCTGGAAGTGGAGCCCGG - Exonic
980085598 4:128387178-128387200 CAGCATGTGGTGGTGACTCATGG + Intergenic
980708003 4:136524358-136524380 CACCTTGTGGAGTTGGGGCATGG + Intergenic
980793528 4:137651098-137651120 AAGCCTGTGGAGGTCGGGCATGG + Intergenic
981136857 4:141220578-141220600 CAAGATGTAGAGGTGGGGAAAGG + Intergenic
981733243 4:147922013-147922035 CAGGAGGTGCAGGAGGGGCAGGG - Intronic
982094067 4:151905060-151905082 AAGCATGTGGGAGTGGTGCAGGG + Intergenic
982116387 4:152101754-152101776 GAGCATGTGCAGCGGGGGCAGGG + Intergenic
982678311 4:158400763-158400785 CAGCATGTAGAAGTGGGTGAGGG + Intronic
983423763 4:167555855-167555877 CTGGAGGTGCAGGTGGGGCAAGG + Intergenic
983567688 4:169171866-169171888 CTGGATCTAGAGGTGGGGCAGGG + Intronic
984550503 4:181153633-181153655 CTGCATGTGGAGGTATGGCACGG - Intergenic
984881073 4:184410404-184410426 CAGCATATGGGGCTGGGGGAAGG - Intronic
985560989 5:585689-585711 CAGCACTGGGGGGTGGGGCACGG + Intergenic
985582267 5:704446-704468 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
986182835 5:5409563-5409585 GAGCAGGTGGATGTGGGGCAGGG - Intergenic
986412585 5:7495190-7495212 CAGAACATGGAGGTGAGGCACGG - Intronic
986656861 5:10021356-10021378 CAGCATGGGAAGGTTGGGTAGGG - Intergenic
987033350 5:13996214-13996236 TAGTATTAGGAGGTGGGGCATGG - Intergenic
987109110 5:14668197-14668219 CAGCATCTGGGGGTGGGGTGGGG - Intronic
988606657 5:32684487-32684509 CAGCATCTTGAGGTGGCACAGGG - Intergenic
989170344 5:38466823-38466845 GAGCATGTGGAAGGAGGGCAAGG - Intergenic
989499622 5:42150249-42150271 CCACATGTGGAGGAGGGGCCTGG + Intergenic
990099516 5:52164246-52164268 GAGAATGTGGAGGTGTGTCAAGG - Intergenic
990754715 5:59056085-59056107 TACCAGGTGGAGGCGGGGCATGG - Intronic
991386956 5:66101231-66101253 CATCAGGTGGGGGTGGGGCTAGG - Intergenic
991941578 5:71858120-71858142 CAGGATGTGGAGCAGGGGCAGGG - Intergenic
992011239 5:72529756-72529778 CAGCAAGGGAAGGTGGGGAAGGG - Intergenic
992190647 5:74288158-74288180 CTCCTTGTAGAGGTGGGGCAGGG - Intergenic
993620422 5:90161679-90161701 CAGTGGGTGGAGGTGGAGCAGGG - Intergenic
994170210 5:96651646-96651668 CAGGGTTTGGAGGTGGGGCATGG - Intronic
994779090 5:104068590-104068612 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
994860814 5:105190518-105190540 AAGCTTGTTGAGGTGGTGCATGG - Intergenic
995198556 5:109400476-109400498 CAGCAGGGGGAGGGGGGGGAAGG + Intronic
996424652 5:123301047-123301069 CAAAATGTGGGGGTGGGGAATGG + Intergenic
996489654 5:124078512-124078534 CAGGGTGTGGGGGTGGGGTAGGG + Intergenic
996735977 5:126758806-126758828 CAGAATGTGGATGTGGTGTAGGG + Intergenic
997589015 5:135061694-135061716 CAGCATCTGGGGGTGGCACAGGG - Intronic
998482336 5:142473390-142473412 AAGGATGAGGAGGTGGGGAAAGG - Intergenic
999513193 5:152274233-152274255 CAGAGGCTGGAGGTGGGGCAGGG - Intergenic
999755900 5:154664068-154664090 CAGCCTCTGGAGGTGGTGCAGGG + Intergenic
1000325175 5:160166639-160166661 GAGCAGGTGGAGACGGGGCAGGG - Intergenic
1002446691 5:179294544-179294566 CAGCTTGTGGAGGTCCGGAATGG + Intronic
1003222005 6:4169084-4169106 CAGAGTGTGTAGGAGGGGCAAGG + Intergenic
1003261296 6:4518602-4518624 AGGCATGGTGAGGTGGGGCAGGG - Intergenic
1003380999 6:5624709-5624731 AATCATGAGGGGGTGGGGCAGGG - Intronic
1003647343 6:7924480-7924502 CAACATGTGGGGGAGGGGCGAGG + Intronic
1003760316 6:9172446-9172468 CAGGAAGTGGGGGTGGGCCATGG - Intergenic
1003882393 6:10490440-10490462 CAGCATCTGAAGGTGGGGCCTGG - Intergenic
1004432979 6:15563095-15563117 GAGCATGTGTAGGTGGGATATGG - Intronic
1005031496 6:21513004-21513026 CAGCATGTACTGGTCGGGCATGG + Intergenic
1005388916 6:25313554-25313576 CAGCATGAGGATGAGGGGCAGGG + Intronic
1005506996 6:26478041-26478063 CAGGAAGTGGAGGTGGGAGATGG + Intergenic
1005786677 6:29251297-29251319 CAGCCTGGGGAGGAGGGGCAAGG + Intergenic
1005852339 6:29830869-29830891 CAGCATGAGGAAGAGGGTCATGG - Exonic
1006055551 6:31381889-31381911 CAGCATGGGGAAGGGGGTCATGG + Intergenic
1006180483 6:32150817-32150839 CTGCCTGTGGCGGTGGGGCTGGG + Exonic
1006614980 6:35320006-35320028 GAGGATGTGGAGGTGAGGCCTGG + Exonic
1007433033 6:41787370-41787392 CAGCCTGTGGAGGTGGGGGTAGG - Exonic
1008966443 6:57317570-57317592 CGCCAAGGGGAGGTGGGGCAGGG + Intronic
1010562046 6:77362604-77362626 CAGCATCCTGAGGTGGTGCAGGG + Intergenic
1010905756 6:81486111-81486133 CAGCATGGGGAGCTGGGGACCGG - Intergenic
1011442096 6:87398256-87398278 CAGTGGGTGGATGTGGGGCAGGG - Exonic
1011789724 6:90885393-90885415 CATCAGGTGGGGGTGGGGCGAGG + Intergenic
1011893299 6:92194023-92194045 CATCAGGTGGGGGTGGGGCTAGG + Intergenic
1013526691 6:110981095-110981117 CAGGAGGGGGAAGTGGGGCATGG + Intergenic
1014505243 6:122247386-122247408 CAGCATGGTGAGCTGGGGCAGGG + Intergenic
1014707039 6:124760352-124760374 AAGCTTGTGTAGGTGGGGCGGGG - Intronic
1016692335 6:146952334-146952356 GAACATGTGGAGGTGGGGGGAGG + Intergenic
1017182339 6:151565147-151565169 CAGCAGCTGCAGGTGGGGTATGG + Intronic
1017712195 6:157180932-157180954 CAGCATGTGGAGGTGGGGCATGG - Intronic
1018171160 6:161144154-161144176 CAGCAAGTGGAAGTGGTGCATGG - Intronic
1018616034 6:165687857-165687879 CAGCCTGGTGAGGTGGGGCCTGG + Intronic
1018862787 6:167723018-167723040 CAGGAGGTGGAGGTGGGGCCTGG + Intergenic
1018945854 6:168346252-168346274 CAGCGTGTGGAGGAGGCGCAAGG + Intergenic
1019211236 6:170407106-170407128 CAGCATGTGGATGTGGGGAAGGG + Intergenic
1019423445 7:962456-962478 GTGTATGTGGAGGCGGGGCAGGG - Intronic
1019504481 7:1383944-1383966 CAGCCTGCCGAGGAGGGGCAGGG + Intergenic
1020222066 7:6246668-6246690 AAGTAGGTGGGGGTGGGGCAGGG - Intronic
1021645142 7:22782374-22782396 CAGATGGTGGAGGTGGGCCAGGG - Intergenic
1021858551 7:24882249-24882271 CAGCAGGTGAGGGTGGGGGAGGG - Intronic
1021982251 7:26066108-26066130 TAGCCTATGGGGGTGGGGCAGGG + Intergenic
1022795435 7:33727903-33727925 CTCCTTGTGGGGGTGGGGCAGGG + Exonic
1023701272 7:42893643-42893665 CATCAGGTGGGGGTGGGGCTAGG - Intergenic
1023818914 7:43969634-43969656 CAGGAGGTAGAGGTGGGGCGAGG + Intergenic
1023841526 7:44101152-44101174 CAGCATGTGTATCTGGGGGAGGG - Intergenic
1023850567 7:44147776-44147798 CAGAATGTGGAGCTGGTGGAGGG - Exonic
1023883548 7:44335116-44335138 GGGGATGTGGAGGTGGGACATGG - Intergenic
1024557276 7:50614445-50614467 CTGGAAGGGGAGGTGGGGCAAGG - Intronic
1024745357 7:52399902-52399924 CATCAGGTGGGGGTGGGGCTAGG + Intergenic
1025253089 7:57365214-57365236 CGGCCTGTGGAAGAGGGGCAGGG - Intergenic
1025641545 7:63377463-63377485 CACTATGTGGACGAGGGGCAAGG - Intergenic
1026132803 7:67634401-67634423 CCGAATTTGGAGGTGGGGCCTGG + Intergenic
1026198873 7:68196659-68196681 CAAAAGTTGGAGGTGGGGCATGG - Intergenic
1026308024 7:69159506-69159528 AAGGATCTGGAGGTGGGGCATGG + Intergenic
1026442003 7:70453007-70453029 CAGGATAGGGAGGTGGGGAAGGG - Intronic
1026542827 7:71295604-71295626 AAGAAAGTGGAGGTGGGGGAAGG - Intronic
1026854449 7:73743750-73743772 CAGCAGGTGCGGGTGAGGCAGGG - Intergenic
1026948673 7:74332940-74332962 CTGCCTGTGGAGGTGGGGACTGG - Intronic
1027046273 7:74993396-74993418 CCAGATGTAGAGGTGGGGCACGG - Intronic
1027157779 7:75780773-75780795 CAGCCTGTGGAGGAGGGGAGAGG - Intronic
1027259762 7:76456541-76456563 CAACACGTGGGGGTGGGGTATGG - Intergenic
1027282712 7:76620351-76620373 CAACACGTGGGGGTGGGGTATGG + Intronic
1027311132 7:76954641-76954663 CAACACGTGGGGGTGGGGTATGG - Intergenic
1027870541 7:83701464-83701486 CAGTCAGAGGAGGTGGGGCATGG - Intergenic
1028134231 7:87209294-87209316 CAGCATGAGGGGGTGGGAAAGGG + Intronic
1029331231 7:99857550-99857572 CAGGAAGTGGAGGCTGGGCATGG + Intronic
1029515024 7:101018584-101018606 CTGGATGTGGAGCTGGGGGACGG - Exonic
1029705153 7:102272217-102272239 GAGCATGTGGGGGTGAGGCTGGG + Intronic
1029743964 7:102506597-102506619 CAGGAGGTAGAGGTGGGGCGAGG + Intronic
1029761953 7:102605760-102605782 CAGGAGGTAGAGGTGGGGCGAGG + Intronic
1029918853 7:104240594-104240616 CAGCATGTGAAAGTAGGTCAAGG - Intergenic
1030143608 7:106330586-106330608 CAGCAGGTGGTGGTGGGAGAAGG + Intergenic
1031685755 7:124730685-124730707 CAGCCTGAGGAGGAGGGGAAAGG - Intergenic
1031970405 7:128060999-128061021 CAGAATTGGGAGGTGGAGCAGGG + Intronic
1032370750 7:131349031-131349053 TAACATGTGGATGTGGGGGAGGG - Intronic
1032716450 7:134512936-134512958 CAGCATGTGTAGGTAGGGAAGGG + Intergenic
1033625483 7:143106471-143106493 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1034213774 7:149387374-149387396 CTTCCTGTGGAGGTGGGGCGTGG - Intergenic
1034548769 7:151807062-151807084 CTGAAGGTGGAGGTGGGGAAGGG + Intronic
1034835495 7:154348085-154348107 CAGCATCAGGAGGTGGGGGTGGG - Intronic
1034922491 7:155095408-155095430 AAGCATGTGCAGGTGGCTCAGGG - Intergenic
1034930589 7:155158623-155158645 TGGCATTTGGAGGTGGGGCCTGG - Intergenic
1034997609 7:155587930-155587952 CAGCATCTGAATGTGGAGCAGGG + Intergenic
1035201529 7:157270395-157270417 CAGCATGTCCAGGTGGGAAAAGG + Intergenic
1035437696 7:158871482-158871504 CAGCAGGTTGTGGTGGGCCACGG - Exonic
1036031756 8:4981697-4981719 CAGCAGGTGGGGGTGCCGCATGG - Intronic
1036777821 8:11625636-11625658 CAGGCTGGGGAGGTGAGGCAGGG + Intergenic
1036837775 8:12089687-12089709 CATCAGGTGGGGGTGGGGCTAGG + Intergenic
1036859568 8:12335935-12335957 CATCAGGTGGGGGTGGGGCTAGG + Intergenic
1037192321 8:16141609-16141631 CTGCATGAGGAGGGAGGGCATGG + Intronic
1038204916 8:25457741-25457763 GAGCCTGTGGAGATGGGTCAGGG - Intronic
1038379497 8:27079309-27079331 AAGAAGGTGGAGGTGGGGCAGGG - Intergenic
1039045330 8:33444362-33444384 CAGCATGGGGAGGAGGAACAAGG + Intronic
1039472254 8:37820840-37820862 CAGCATGGGCAGGATGGGCAAGG + Intronic
1039499102 8:38002766-38002788 CAGCCTGGGGAGGAGGGGAAAGG + Intergenic
1040989279 8:53331999-53332021 AAGAAAGTGGAGGTTGGGCATGG - Intergenic
1041311221 8:56518893-56518915 GAGCCTGTGGAGGGTGGGCAAGG + Intergenic
1042175947 8:66037070-66037092 TAGCATCTGGAGGTGAGGCCTGG + Intronic
1043880710 8:85539390-85539412 CAGCAAGAGGAGGTGGGCCGAGG - Intergenic
1045779832 8:105849854-105849876 CATCAGGTGGGGGTGGGGCTAGG - Intergenic
1047351743 8:124080683-124080705 CAGCTTGGGGAGATGGGCCAGGG + Intronic
1047634731 8:126748501-126748523 TAGCAAGTGGAGGAGGGGCTTGG + Intergenic
1048285421 8:133137539-133137561 CAGCATGTCCAGGAGGGGCGGGG + Intergenic
1048290341 8:133176460-133176482 TGGCAAGTGGATGTGGGGCAAGG - Intergenic
1049195840 8:141315229-141315251 CAGGATGGGGAGGAGGGGCAGGG + Intergenic
1049399319 8:142417843-142417865 CAGCTTGTGGGGGCGGGGCTTGG - Intergenic
1049603264 8:143517851-143517873 CTGTGTGTGCAGGTGGGGCAGGG - Intronic
1049616158 8:143576635-143576657 CAGCGTGTGGAGGTGAGCCCGGG - Exonic
1049706747 8:144046574-144046596 CTGTGTGTGGAGGTGTGGCAAGG + Intronic
1049744248 8:144256458-144256480 CAGCCTGTGGTGCTGGGGCAGGG - Intronic
1049800068 8:144513560-144513582 CAGGGTCTGGAGGTGCGGCATGG - Exonic
1050146772 9:2576494-2576516 AAGCTTGTGGGGGTGGGGGATGG + Intergenic
1050351162 9:4741770-4741792 CGCCAGGTGGAGGTGGGGCCAGG - Intronic
1051052531 9:12949976-12949998 CAGCCTGGGGAGGAGGGGAAAGG - Intergenic
1051264858 9:15300503-15300525 CAGGATGTGGAGGTGGCAGAAGG - Intronic
1051609832 9:18950366-18950388 CAGCTTGGGTAGGTGGGGGATGG - Intronic
1052218919 9:25997017-25997039 CAGCCTGCACAGGTGGGGCATGG - Intergenic
1052401110 9:28001250-28001272 TGGCATGTGGAAGAGGGGCAAGG - Intronic
1053130942 9:35615368-35615390 CAGTAAGTGGAGATGGGGAAAGG - Intronic
1054707877 9:68480978-68481000 AAGAACTTGGAGGTGGGGCAAGG + Intronic
1054790057 9:69248213-69248235 CAGCACGAGGAGGTGAGGCGAGG + Exonic
1054931761 9:70642453-70642475 AACAATGAGGAGGTGGGGCAGGG + Intronic
1055905809 9:81292392-81292414 CACCAGGTGGGGGTGGGGCTAGG + Intergenic
1056603965 9:88069746-88069768 TAGCTTGTGCAGGCGGGGCATGG - Intergenic
1057212950 9:93210404-93210426 CAGGCTGTGGAGTTGGGTCAGGG + Intronic
1057431199 9:94996004-94996026 CTGCATGTGGAGGTGGAGAGTGG - Intronic
1058026302 9:100144758-100144780 CAGCCTGGGGAGGAGGGGAAAGG + Intronic
1059572336 9:115452552-115452574 CAAAATTTGGAGGTTGGGCATGG + Intergenic
1059882878 9:118711294-118711316 TAGGATTTGGAGGTGGGGCCTGG - Intergenic
1060269810 9:122132455-122132477 CAGCAAGTGGAAGGGAGGCAGGG - Intergenic
1060402632 9:123357312-123357334 CAGCCTGTGGTGGTGGGGGCAGG - Intronic
1060537246 9:124400097-124400119 CAGTGAGTGGGGGTGGGGCAAGG - Intronic
1060587894 9:124797951-124797973 CAGCAAGGGGAGATGAGGCAGGG + Intronic
1060681449 9:125568569-125568591 CAACATGTGGTGGCTGGGCAGGG - Intronic
1060965053 9:127707545-127707567 CAGGAAGTGGAAGTGGGGCCTGG - Intronic
1061224638 9:129273728-129273750 CAGGGTGTGGAGGGAGGGCATGG - Intergenic
1061302241 9:129712036-129712058 CAAGAAGTGGAGGTGGGGTAGGG - Intronic
1061793008 9:133068399-133068421 CAGCCTGGGGACGTGTGGCAGGG + Intronic
1061795613 9:133084183-133084205 CAGCCTGGGGACGTGTGGCAGGG + Intronic
1061896619 9:133651797-133651819 CAGGGTGTGGGGGCGGGGCAGGG - Intronic
1062193251 9:135258487-135258509 CAGCTGGTGGAGGTGGGGCAGGG - Intergenic
1062326930 9:136016973-136016995 CAGCAAGGGGCAGTGGGGCATGG + Intronic
1062463735 9:136672337-136672359 CAGCATGTTGGGCAGGGGCATGG - Exonic
1062525690 9:136977247-136977269 CAGCAGGAGGAGGGTGGGCAAGG + Intergenic
1062663339 9:137652178-137652200 CAAGATGTGGAGGTGGGAGACGG + Intronic
1185593456 X:1293609-1293631 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593496 X:1293783-1293805 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593517 X:1293869-1293891 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593546 X:1293999-1294021 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185789035 X:2914528-2914550 CTGCATTTTCAGGTGGGGCAAGG - Intronic
1185827253 X:3263983-3264005 CAGCATATAGAGATGGGGCCAGG - Intergenic
1186285916 X:8043955-8043977 CGGCATGAGTAGGTGGGGTAAGG + Intergenic
1186540932 X:10399170-10399192 CAGGAGGTGGGGGTGGGGCATGG - Intergenic
1187378557 X:18779431-18779453 TAGCCTGTGAAGGTCGGGCATGG - Intronic
1187748391 X:22433721-22433743 CATCAGGTGGGGGTGGGGCTAGG - Intergenic
1188063712 X:25631557-25631579 TAACATGTGGAGGTGGGTCTTGG + Intergenic
1189007651 X:37011204-37011226 CAGCATGTGAAGATGGGGTATGG + Exonic
1189211863 X:39290529-39290551 GAGCATTTGGTGGTGGGGGAGGG - Intergenic
1192192373 X:68999209-68999231 CAGCAGGTTGAGGTGGAGCTGGG - Intergenic
1192588533 X:72340246-72340268 CAGCTTGTGGAGCTGGGCCCCGG + Intronic
1192668406 X:73112300-73112322 GAGAATGTGGAGGTGTGTCAAGG - Intergenic
1192914515 X:75638194-75638216 CATCAGGTGGGGGTGGGGCTAGG + Intergenic
1193937628 X:87641919-87641941 CATCAGGTGGGGGTGGGGCTAGG - Intronic
1194501013 X:94680819-94680841 CCCCATGTGGAGGTGGAGCCTGG + Intergenic
1194699475 X:97096034-97096056 CAGCAGGTGGGGTTGGGGGACGG + Intronic
1195015317 X:100773815-100773837 TAGCAGGTGGAGGAGGGGAAAGG - Intergenic
1197178904 X:123513102-123513124 CAGTATTTGGAGTAGGGGCAAGG - Intergenic
1197249624 X:124201523-124201545 CAGAATAAGGAGGTTGGGCACGG + Intronic
1197499623 X:127228215-127228237 CAGCATGGGGAGGAGGGGAGAGG - Intergenic
1197953706 X:131923927-131923949 CACCAGGTGGGGGTGGGGCTAGG - Intergenic
1198052283 X:132960765-132960787 CAGCATGAGGGGGTGGAGGAAGG - Intronic
1199235527 X:145488048-145488070 CAGCATCTTCAGGTGGTGCAGGG + Intergenic
1200105959 X:153712581-153712603 AAGCATGTGGAGGCTGGGCGTGG + Intronic
1200134324 X:153867585-153867607 CAGCATGTGGCTTTGGGGGAAGG + Intronic
1200397288 X:155998703-155998725 CAGCCTCTGCAGGTGGGGCGGGG + Intronic
1201226867 Y:11826999-11827021 CTGCATCTGGAGGTGGGTCCTGG + Intergenic
1202379373 Y:24262268-24262290 GGGCAGGTGGAGGTGGTGCAGGG + Intergenic
1202491409 Y:25407853-25407875 GGGCAGGTGGAGGTGGTGCAGGG - Intergenic