ID: 1017715354

View in Genome Browser
Species Human (GRCh38)
Location 6:157207162-157207184
Sequence CAGCAAAGATGAGTGGTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017715341_1017715354 24 Left 1017715341 6:157207115-157207137 CCGCAGACCTATGAGAAAGAGGA 0: 1
1: 0
2: 0
3: 24
4: 258
Right 1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG 0: 1
1: 0
2: 3
3: 28
4: 268
1017715343_1017715354 17 Left 1017715343 6:157207122-157207144 CCTATGAGAAAGAGGAGGATGAG 0: 1
1: 1
2: 9
3: 46
4: 478
Right 1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG 0: 1
1: 0
2: 3
3: 28
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017715354 Original CRISPR CAGCAAAGATGAGTGGTGGT GGG Exonic
900857800 1:5200008-5200030 AAGCAAAGAGGAGAGGTTGTGGG + Intergenic
901850684 1:12012922-12012944 CCTCAAAGATGAGTGATGGCTGG - Exonic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
903918220 1:26780027-26780049 CAACAAAGTGGAGTGGTGGTGGG + Exonic
904558931 1:31383935-31383957 CAGAGAAGGTCAGTGGTGGTTGG - Intergenic
904703498 1:32373361-32373383 CAGAAAAAATCAGTAGTGGTTGG - Intronic
905486865 1:38305333-38305355 TATCAAAGATAAGTGTTGGTGGG + Intergenic
905878968 1:41451185-41451207 CAGCACAGAAGGGTGGTGGCAGG - Intergenic
907804202 1:57802207-57802229 CAACAATGAGGACTGGTGGTAGG + Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
911093164 1:94033901-94033923 CAGCAAAGAGGAGGGGCAGTAGG - Intronic
911442103 1:97939612-97939634 TAAGAAAGATCAGTGGTGGTAGG + Intergenic
911563636 1:99436113-99436135 CTGCAAAAATGAGTTGTGGCAGG + Intergenic
912272399 1:108224408-108224430 CAACAGTCATGAGTGGTGGTTGG + Intronic
912295822 1:108469913-108469935 CAACAGTCATGAGTGGTGGTTGG - Intronic
912960586 1:114192124-114192146 CAGCTCAGATGAGTGGCAGTAGG - Intergenic
913007030 1:114644111-114644133 CAGTAAAGATGATAAGTGGTGGG - Intronic
913073103 1:115318631-115318653 CAACAAAGAAGAGAGGTGGCTGG - Intronic
913112161 1:115666443-115666465 CAGCAGAGCTGTGTGGTGGGAGG - Intronic
916078493 1:161217598-161217620 CAGCCAAGATGGGTAGTGGGAGG - Intronic
918877397 1:190065781-190065803 CATCAAAGATAAGTGGTCATGGG + Intergenic
919592845 1:199526201-199526223 TAACAAACATGATTGGTGGTGGG + Intergenic
919851222 1:201674290-201674312 CAGCAGAGAGGAAGGGTGGTGGG + Intronic
920761042 1:208783999-208784021 CAACAAAGCCCAGTGGTGGTGGG + Intergenic
923867795 1:237959016-237959038 CAGCATAGTTGAGTAGTGGTGGG - Intergenic
1063620254 10:7640792-7640814 GAGAAAAGAAGAGTGGTGATAGG - Exonic
1064744103 10:18462235-18462257 CAGCAAATAGGAGCGCTGGTTGG + Intronic
1065482441 10:26209395-26209417 CAGAAAAAATGGGTGGTTGTAGG - Intronic
1067328610 10:45293272-45293294 CAGGGAAGCTGAGTGGAGGTTGG + Intergenic
1067708889 10:48633138-48633160 CAGCAAACATGAGTTGTGCCAGG - Intronic
1069561421 10:69433161-69433183 CAGCCAAGTTGATTGGTGCTGGG - Intergenic
1070476782 10:76836657-76836679 CAGCCAAGTTGATTGGTGCTGGG + Intergenic
1070604316 10:77888154-77888176 CATCAAAGATGAGAGGTGGGCGG + Intronic
1070946908 10:80399745-80399767 CAGCAAATACTAGGGGTGGTGGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071630304 10:87214248-87214270 CAGCTGGGCTGAGTGGTGGTGGG - Intergenic
1072013498 10:91323678-91323700 CATCAAAGATGATGGGTGGCCGG + Intergenic
1072393147 10:95010064-95010086 CAGCAGAGATAATTTGTGGTAGG + Intergenic
1073765021 10:106672812-106672834 CAGGAAGCATGAGTGGTGTTGGG - Intronic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1077537799 11:3132820-3132842 CAGCGCAGGTGAGGGGTGGTGGG + Intronic
1077917710 11:6622054-6622076 CGGCAGTGATGAGGGGTGGTGGG + Exonic
1078576849 11:12509869-12509891 CAGCATAGGGGAGGGGTGGTGGG - Intronic
1078611438 11:12823079-12823101 GAGCAAAGATGAGATGTGCTGGG - Intronic
1080115295 11:28615228-28615250 CACCAATGATGAATGGTAGTTGG - Intergenic
1080148895 11:29024553-29024575 CAGGAAAGATGAGTGGGGGCCGG - Intergenic
1080333322 11:31167891-31167913 CAGCATTGATGAGTGATGGTGGG - Intronic
1080858329 11:36131196-36131218 AAGCACAGATTACTGGTGGTGGG - Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083200826 11:61119998-61120020 CAGCAATGGTGAGAGGTGGGAGG + Intronic
1084360735 11:68667197-68667219 CAGCAGAGATGAGGGGCGCTGGG + Intergenic
1084360766 11:68667341-68667363 CAGCAGAGATGAGGGGCGCTGGG + Intergenic
1084462518 11:69303814-69303836 CAGCGAAGACCAGTGGTGGTCGG + Intronic
1084954420 11:72683886-72683908 CAGCAATGATGAGTGGTCCATGG + Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1087183374 11:95160654-95160676 CAGCAGAGATGAGGAGCGGTAGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1091317588 11:134625332-134625354 GAGCAAAGAAGAGGGGTGGCTGG + Intergenic
1091671439 12:2454887-2454909 CAGCATAGACGCGTGGTTGTGGG - Intronic
1091788683 12:3258502-3258524 CAGCAATGAAGAGTGGTCGTGGG + Intronic
1092062406 12:5562118-5562140 CGGCAATGATGAGTGATGTTTGG + Intronic
1094648287 12:32349114-32349136 AAGCAAAGAAGAGTTCTGGTGGG + Intronic
1095874622 12:47067273-47067295 AAGCAAAGAGGAGTTGAGGTGGG + Intergenic
1096253033 12:50045541-50045563 CAGAAAAGATGAGTCCTGGTCGG - Intergenic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097835070 12:64264749-64264771 CAGCAGAGAAGAATAGTGGTTGG + Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099542721 12:83933517-83933539 CAACAAAGATAAGTGTTGGTGGG + Intergenic
1100664396 12:96735512-96735534 CTGTAAAAATGACTGGTGGTGGG + Intronic
1100816913 12:98395662-98395684 CACCAAAGAAGAGTGGTGGAGGG + Intergenic
1100982866 12:100176216-100176238 CAGCAAAGATGACAGATGGAAGG + Intergenic
1101716293 12:107315980-107316002 CAGTAAACCTGGGTGGTGGTGGG - Intergenic
1103295216 12:119880597-119880619 CTGCAAAGTTGATTGTTGGTAGG - Intergenic
1105636812 13:22223629-22223651 CAGCACAGCTGCGTGGTGGAAGG - Intergenic
1105977807 13:25488873-25488895 CAGCAAAAATGGGGGGTGGGGGG - Intronic
1107079319 13:36357342-36357364 CAGCAAAGATGACTTGTGACTGG - Intronic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110119269 13:71864122-71864144 CAGTAAAGATGGGGGGTGGTGGG - Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113095919 13:106663633-106663655 CAGCCAAGTTGATTGGTGCTGGG + Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1119936458 14:78596461-78596483 CAGCAAACCTGAGAGGTGGCAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120573238 14:86147948-86147970 TAGCAATGATGAGTGTTTGTTGG - Intergenic
1120723887 14:87916613-87916635 CAGCAAAGAGGTGTGGCGGGTGG + Intronic
1121831924 14:97060185-97060207 CAGCCATGTTGAGAGGTGGTTGG + Intergenic
1125223286 15:37365737-37365759 CAACCTAGATGTGTGGTGGTGGG + Intergenic
1125715284 15:41816536-41816558 CTGCAAAGATGAGGAGAGGTGGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1128496094 15:68199526-68199548 CGGGATAGGTGAGTGGTGGTGGG - Exonic
1128878244 15:71219928-71219950 CAGAAAAGCTGTGTGGAGGTTGG + Intronic
1130643713 15:85704426-85704448 CGCCAAAGATCTGTGGTGGTTGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1133305255 16:4804353-4804375 GAGCCAAGAGGAGTGGGGGTTGG - Exonic
1134241022 16:12506910-12506932 ATGCAAAAATGAGTGGTGATCGG - Intronic
1136429106 16:30186713-30186735 CAGTCATGGTGAGTGGTGGTGGG + Exonic
1136475859 16:30513057-30513079 CAGGAAAGATGAGTGTGGGTTGG + Intronic
1139373713 16:66483995-66484017 CTGCAATTATGAGTGCTGGTGGG - Intronic
1139673382 16:68506778-68506800 CCGAAAAGATGTGTGGAGGTGGG + Intergenic
1139777535 16:69325879-69325901 CAACACAGATGAGTGGGGATGGG - Exonic
1139869296 16:70091502-70091524 GAGAAAAAATGAGTGGTGGGAGG + Intergenic
1140386087 16:74540637-74540659 GAGAAAAAATGAGTGGTGGGAGG - Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142415410 16:89938582-89938604 CAGCAGACATGAGGGGTGCTGGG - Intergenic
1143119542 17:4598325-4598347 GGGCACAGATGAGTGGTGTTCGG + Intronic
1145978214 17:28996444-28996466 CAGCAAACCTGAGTGGGGGAGGG + Intronic
1147289950 17:39433700-39433722 CAGCTTAGATGGGTGGTGATGGG - Intronic
1148219879 17:45853765-45853787 CAGCAAAGATTGGTGGGGTTTGG + Intergenic
1148229740 17:45924439-45924461 CAGCAAAGAGGAGTGGAGGCCGG - Intronic
1148353535 17:46958382-46958404 TAGCAAAGAAGACTGGGGGTGGG + Intronic
1149591674 17:57834481-57834503 AAGCAAAGGTGAGTGGAGGAGGG - Intergenic
1150453139 17:65286073-65286095 GAGAAAAGATGAGTGAGGGTAGG - Intergenic
1151072646 17:71233573-71233595 CAGCTATATTGAGTGGTGGTTGG + Intergenic
1151397094 17:73830521-73830543 GAGAAAATATGAATGGTGGTGGG + Intergenic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1152892730 17:82891721-82891743 CAGCAGGGATGGGGGGTGGTTGG + Intronic
1153216065 18:2822026-2822048 CACCAAAGATGTGTGGCAGTGGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153499976 18:5738768-5738790 CAGCAAAGATAAGCGGTGGTGGG + Intergenic
1154169015 18:12037425-12037447 CAGCAAAATGGAGTGGTGGGAGG - Intergenic
1155822373 18:30394465-30394487 TAGGAAAGATGAGTGGAGTTGGG + Intergenic
1160429324 18:78800607-78800629 CAGCAAGGATGAGTGCAGGGAGG - Intergenic
1161090612 19:2358175-2358197 CAGCAGTGAAGAGTGGTGGGTGG - Intergenic
1161350780 19:3790312-3790334 CACCAAGGATGAGAGGTGGAGGG - Intronic
1161711463 19:5851008-5851030 CAGAAAAGATGAGTGGGGGGAGG + Intronic
1163645988 19:18489435-18489457 CAGCAGGAGTGAGTGGTGGTTGG - Intronic
1163866628 19:19778447-19778469 CCAAAAAGATTAGTGGTGGTAGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164849570 19:31470465-31470487 CAGCAAAGAGGGGTGGAAGTTGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1166367999 19:42286913-42286935 GAGCAAAGGTGAGGGCTGGTGGG + Exonic
1166741933 19:45119769-45119791 CTGCACACATGAGAGGTGGTGGG + Intronic
1167513753 19:49910703-49910725 CACCAGAGATGGGTGGGGGTGGG + Intronic
1168234925 19:55056648-55056670 CAGCAAAGATCATTGAAGGTAGG - Exonic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
927244576 2:20947184-20947206 CAGAATAGATGTGGGGTGGTGGG + Intergenic
927888502 2:26733144-26733166 CAGCACAGCAGAGTGGAGGTGGG + Exonic
928405084 2:31008656-31008678 CAGCCAGCATGAGTGGTGGGAGG + Intronic
929234697 2:39593636-39593658 CAGGAAAGCTAAGTCGTGGTTGG + Intergenic
930852486 2:55975580-55975602 AAGCAAAGAGGAGTCGGGGTGGG + Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
931268720 2:60683251-60683273 CAGGGAAGATCAGTTGTGGTCGG + Intergenic
931658142 2:64529029-64529051 CAGTAGAGATGAGAAGTGGTAGG + Intronic
931917212 2:66969320-66969342 CAGGAAAGCAGAGTGGAGGTTGG + Intergenic
935116920 2:100144743-100144765 AAGAAACCATGAGTGGTGGTGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936462277 2:112722394-112722416 CAGAAGGGATGCGTGGTGGTTGG + Intronic
937340641 2:121088565-121088587 CAGGACAGATAAGTGGTGGAAGG + Intergenic
938015210 2:127861177-127861199 CAGAAAAGATGAGATGTGTTTGG - Intergenic
939419043 2:141942216-141942238 GAGAAAAGATGTGTGGTGGAGGG - Intronic
940545086 2:155072850-155072872 AAGCAAAGAGGGGTGGTGGGTGG + Intergenic
940667644 2:156628167-156628189 CAGCACTGGTGAGTGGTGATAGG + Intergenic
941686993 2:168456909-168456931 GAACAAAGGTGAGCGGTGGTCGG + Intronic
943418205 2:187635608-187635630 AAGCAAAGATGAGTTGTGTAGGG + Intergenic
944414641 2:199469521-199469543 AAGAAAAGAAAAGTGGTGGTGGG + Intronic
944981024 2:205120059-205120081 GGACAAAGATGAGTGGTTGTGGG + Intronic
947982837 2:234425257-234425279 CTACAAAGATGAAGGGTGGTGGG + Intergenic
1169207144 20:3746993-3747015 CAACAAAGGTGGGCGGTGGTGGG - Intronic
1170377137 20:15712450-15712472 CAGTAAAAATTAGTAGTGGTGGG - Intronic
1170451246 20:16486436-16486458 AAGAAGAGATGAGAGGTGGTGGG - Intronic
1173371691 20:42442072-42442094 CAGCAAAGCTGAGGGATGGGAGG + Intronic
1175457260 20:59124804-59124826 CAGCAAAGATGAGGAGTGGCGGG - Intergenic
1175478966 20:59298345-59298367 CAGTGAAGACAAGTGGTGGTCGG + Intergenic
1175554226 20:59836418-59836440 CTGCAAGGATGAGAGGTGGCTGG - Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177783858 21:25648525-25648547 CAACAGAGATGAATGGAGGTTGG - Intronic
1177829821 21:26125511-26125533 CAGTAAACAGGAGTGGAGGTAGG + Intronic
1178666147 21:34548163-34548185 TTCCAAAGCTGAGTGGTGGTAGG - Intronic
1179916399 21:44480820-44480842 CAGCAGGGATGTGTGGGGGTGGG + Intergenic
1181350047 22:22248451-22248473 CAACAAAGATGAGGAGTGGTGGG - Intergenic
1182114718 22:27749543-27749565 GAGCAGAGATGAGTGGTGGTTGG - Exonic
1182551357 22:31102521-31102543 GAGCACAGATGAGTGGCGGATGG + Intronic
1183691621 22:39392866-39392888 CAGCAAGGATGACAGGCGGTGGG - Intergenic
1184072506 22:42154769-42154791 CAGCAAACATGGGTGGTGGGTGG - Intergenic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184929191 22:47668226-47668248 CACCAAACATGAGTTTTGGTGGG - Intergenic
1185370899 22:50460426-50460448 CAGCAAAGGTGAGAGGAGGAGGG + Intronic
949686785 3:6583001-6583023 CTGGAAAGATCAGTGGTTGTGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950180956 3:10912764-10912786 CAGCAAGGCTGAGTCGTGGAGGG + Intronic
950500299 3:13359422-13359444 CAGAAAAGATGCCTGGTGATAGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952083500 3:29789659-29789681 GAGGAATGATGGGTGGTGGTGGG - Intronic
952944489 3:38468540-38468562 CAACCATGATGAGTGGTGGTGGG + Intronic
953500510 3:43428452-43428474 CAGCAATGATGAGTGTTGTCAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959824003 3:110771189-110771211 CAGAAAAGGTGAGTTGTTGTTGG + Intergenic
961559156 3:127716988-127717010 CAGCAAAGATGTGTGGCAGGAGG + Intronic
962499919 3:135980875-135980897 TAGCACAGATGAGTGGTAGCGGG + Intronic
964768778 3:160203275-160203297 CAGGAAGGGGGAGTGGTGGTGGG - Intergenic
965520219 3:169663036-169663058 CAGCAAAGACTAGGGGTGGGAGG - Intronic
967369105 3:188723221-188723243 CAGTAAAGCTGTGTGGTGGTTGG - Intronic
969161369 4:5262071-5262093 CAGCAAAGATGAGGGGAAGGAGG - Intronic
969244815 4:5925261-5925283 CAGCAAGGAGGTGTGGTGGGGGG + Intronic
969954752 4:10877398-10877420 GAGCAAAGATGTGGAGTGGTGGG + Intergenic
970613209 4:17744522-17744544 CAGCAGAGATGAGAGGTGAATGG - Intronic
971070303 4:23083411-23083433 TAGCAATGATGAGAAGTGGTTGG + Intergenic
973651947 4:53005329-53005351 CAGCAGAGATCAGCAGTGGTGGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
982466127 4:155734626-155734648 CAGCATATATGAGAGGTGGGAGG + Intergenic
982914155 4:161184093-161184115 CAGAAGAGATGACTGGTGATAGG + Intergenic
987452693 5:18106007-18106029 CAAGAAAGAGGAGTGGAGGTAGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990614563 5:57494424-57494446 CTGCAAAGTTTAGTGGTGTTTGG - Intergenic
990787377 5:59437542-59437564 CAGCAAAGAGGAGGGGTCTTTGG + Intronic
991303833 5:65155113-65155135 AATAAAAGATGAGTCGTGGTTGG - Intronic
993308153 5:86295584-86295606 CAACAGTCATGAGTGGTGGTTGG - Intergenic
995051649 5:107713396-107713418 GAGAAAAGATTAGTGGTTGTCGG + Intergenic
995124088 5:108562994-108563016 CAGAAATGATGAGTGGGGATGGG - Intergenic
997360940 5:133294461-133294483 CAGCAAAGAGGGGCGGTGGGTGG - Intronic
997384904 5:133464949-133464971 CAGCAAAGGTAGGTGGGGGTTGG - Intronic
997466351 5:134090553-134090575 CAGGAAAGATAAGTGATGATTGG + Intergenic
997670568 5:135668125-135668147 AAGCAATCATGAATGGTGGTTGG + Intergenic
997833690 5:137174994-137175016 CTGCAAAGATGTGTGGTGGTCGG - Intronic
998098570 5:139412849-139412871 CAGAAAAGATGAGGGGTCATGGG + Exonic
1001052128 5:168422090-168422112 CTGAAAAGGTGAGTGGTGGGCGG + Exonic
1001747903 5:174106057-174106079 CAGTAAGGATGAGTGATGGAAGG + Intronic
1001969114 5:175939491-175939513 CAGCACAGATGACTGGTGGGTGG - Intronic
1001975689 5:175996779-175996801 CAGCACAGATGACTGGTGGGTGG - Intronic
1002241739 5:177846993-177847015 CAGCACAGATGACTGGTGGGTGG + Intergenic
1002248326 5:177904252-177904274 CAGCACAGATGACTGGTGGGTGG + Intergenic
1002559988 5:180074546-180074568 CAGAAAAGAAGAATGGTAGTTGG - Intergenic
1002806225 6:577066-577088 CAGCAAAATTGGGTGGTGGTGGG + Intronic
1003269148 6:4591922-4591944 CAGCAAGGATGAGGTGTGTTTGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004324702 6:14664462-14664484 AAGCACAGATGAGTGGAGGGCGG + Intergenic
1004505629 6:16244579-16244601 CAGCAGAGATGTGTGTTTGTGGG + Intronic
1006522087 6:34576663-34576685 CAGCGAAGACCAGCGGTGGTCGG + Intergenic
1007666975 6:43520178-43520200 CCACAAAGGTGAGTAGTGGTAGG + Exonic
1008012612 6:46484756-46484778 CAGCATACATGAGTGTTTGTAGG - Intronic
1009888385 6:69652208-69652230 CACGAGAGATGAGTGTTGGTGGG - Intergenic
1012077561 6:94710858-94710880 GAGCAATTATCAGTGGTGGTTGG + Intergenic
1012930569 6:105311768-105311790 CAGCATTGATGGGTGGAGGTGGG - Intronic
1013337887 6:109183626-109183648 CTGCAGAGGTGAGGGGTGGTGGG + Intergenic
1013976238 6:116081994-116082016 CAGCAAAGATAAATGGTGTGTGG + Intergenic
1014713493 6:124837688-124837710 CAACAAGGATGGGTGGTGGATGG - Intergenic
1014821994 6:126000239-126000261 CAGCAAAATTGAGTGGAAGTAGG - Intronic
1015195648 6:130522251-130522273 CAGCAAAGATCTATGATGGTGGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1017703600 6:157099110-157099132 CTACAAAAATGCGTGGTGGTGGG - Intronic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1017851012 6:158305966-158305988 TAACAAAAATGAGTGGTGTTGGG - Intronic
1017947940 6:159110999-159111021 CAGGAAAGCAGAGTGGTGCTTGG + Intergenic
1019126091 6:169840948-169840970 CAGCAAAGAGGGGTGGGGGTGGG - Intergenic
1020605537 7:10332317-10332339 CTGCAAAGGAGAGTGGTGGCTGG + Intergenic
1021946625 7:25734025-25734047 CTGCAAATGAGAGTGGTGGTTGG - Intergenic
1022472376 7:30689599-30689621 CAGCAAAGCTGGGTGGGGGGTGG + Intronic
1023665378 7:42517722-42517744 CAACAAAGAGGAGTGGTAGATGG + Intergenic
1023833949 7:44057670-44057692 CAGCACAGGTGAGTGCTGCTAGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024835143 7:53509291-53509313 CAGCAAAGATGAGATTTTGTTGG - Intergenic
1025104953 7:56163116-56163138 CAGCGAAGACCAGCGGTGGTCGG - Intergenic
1028223551 7:88223532-88223554 CAGCAGAGTTGAGTGGTATTTGG - Intronic
1033344751 7:140518305-140518327 GAGCTAAGAGGAGTGGTGATGGG - Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1035469061 7:159098166-159098188 CAGCACAGAAGAGTTGTGATGGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037382522 8:18302248-18302270 AAGGACAGATGAGTGGTGCTAGG - Intergenic
1038288933 8:26231173-26231195 CAGGAAGGGAGAGTGGTGGTAGG - Intergenic
1041154468 8:54971006-54971028 CGGGAAGGGTGAGTGGTGGTGGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052159339 9:25235649-25235671 CAGCAAAGATGTGAGGTGCATGG - Intergenic
1052178693 9:25498734-25498756 CATAAAAGATAAATGGTGGTGGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056952875 9:91058920-91058942 GAGCAAGGGTGAGTGGTGCTAGG + Intergenic
1057045631 9:91884325-91884347 CAGCAGGGATGTGTGTTGGTGGG + Intronic
1058249901 9:102680396-102680418 CAGAAAAGATGAGTGATCATGGG + Intergenic
1059533356 9:115058460-115058482 CAGAAAAGATCAGAAGTGGTGGG + Intronic
1061549591 9:131325697-131325719 CAGCACAGCTGAGTGCAGGTGGG + Intergenic
1061969236 9:134035028-134035050 CAGCAGATGTGGGTGGTGGTGGG - Intronic
1062138233 9:134940918-134940940 AAGCAAAGTGGGGTGGTGGTGGG + Intergenic
1062331433 9:136046505-136046527 CTGCAGAGATGAGGGCTGGTGGG + Intronic
1186697631 X:12054139-12054161 CAGAGGAGATGAGTGGTGTTTGG + Intergenic
1189701158 X:43717079-43717101 TAAGAAAGATGAGTGATGGTGGG + Intronic
1189701788 X:43720196-43720218 CAGGAAAGGTGGGTGGTGTTAGG + Intronic
1190181647 X:48197508-48197530 CAAAAAATATGAGTGGGGGTGGG - Intronic
1190191327 X:48279711-48279733 CAAAAAATATGAGTGGGGGTGGG - Intergenic
1190809483 X:53869549-53869571 AAGCAAAGAGGGGTGGTGGTGGG - Intergenic
1191868541 X:65725769-65725791 TAGAAAAGATCAGTGGGGGTGGG - Intronic
1191942994 X:66499914-66499936 CAGGAAAGCTGAGTGGAGGGTGG - Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1194641312 X:96406779-96406801 CAGCATACATGAGTGGTGAAAGG - Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1197005167 X:121487804-121487826 CAGCAATAATGATTGGAGGTTGG + Intergenic
1198438796 X:136641641-136641663 CAGCATAGATGAGTGTGGTTGGG - Intergenic
1199163483 X:144642721-144642743 TAGCAAAGGTGAGTGAGGGTGGG + Intergenic
1200591737 Y:5083428-5083450 GGGCCAAGATGAGTGGCGGTGGG - Intronic