ID: 1017716475

View in Genome Browser
Species Human (GRCh38)
Location 6:157217169-157217191
Sequence TGCAAAACCCCCAGTGGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017716475_1017716486 4 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716486 6:157217196-157217218 CCAAGCAGGGTGGGCCGGGCTGG No data
1017716475_1017716479 -9 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716479 6:157217183-157217205 GGTTTTGCAAAACCCAAGCAGGG No data
1017716475_1017716481 -5 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716481 6:157217187-157217209 TTGCAAAACCCAAGCAGGGTGGG No data
1017716475_1017716490 10 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716490 6:157217202-157217224 AGGGTGGGCCGGGCTGGGGAGGG No data
1017716475_1017716489 9 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716489 6:157217201-157217223 CAGGGTGGGCCGGGCTGGGGAGG No data
1017716475_1017716483 0 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716483 6:157217192-157217214 AAACCCAAGCAGGGTGGGCCGGG No data
1017716475_1017716482 -1 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716482 6:157217191-157217213 AAAACCCAAGCAGGGTGGGCCGG No data
1017716475_1017716478 -10 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716478 6:157217182-157217204 GGGTTTTGCAAAACCCAAGCAGG No data
1017716475_1017716488 6 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716488 6:157217198-157217220 AAGCAGGGTGGGCCGGGCTGGGG No data
1017716475_1017716487 5 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716487 6:157217197-157217219 CAAGCAGGGTGGGCCGGGCTGGG No data
1017716475_1017716480 -6 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716480 6:157217186-157217208 TTTGCAAAACCCAAGCAGGGTGG No data
1017716475_1017716491 16 Left 1017716475 6:157217169-157217191 CCGAACCCACTGGGGGTTTTGCA No data
Right 1017716491 6:157217208-157217230 GGCCGGGCTGGGGAGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017716475 Original CRISPR TGCAAAACCCCCAGTGGGTT CGG (reversed) Intergenic
No off target data available for this crispr