ID: 1017716802

View in Genome Browser
Species Human (GRCh38)
Location 6:157218653-157218675
Sequence GGCTCCCCAAGGCCCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017716794_1017716802 12 Left 1017716794 6:157218618-157218640 CCTGAGGTTGAAGGTGAGGCTGA No data
Right 1017716802 6:157218653-157218675 GGCTCCCCAAGGCCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017716802 Original CRISPR GGCTCCCCAAGGCCCCCGGC TGG Intergenic
No off target data available for this crispr