ID: 1017717212

View in Genome Browser
Species Human (GRCh38)
Location 6:157221416-157221438
Sequence GAGAACGGCTGCCGGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017717212_1017717223 12 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717223 6:157221451-157221473 GGCAGGGGCCGATTCAGCCTGGG No data
1017717212_1017717214 -9 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717214 6:157221430-157221452 GCCGTTCTCCCTTTCCTAGACGG No data
1017717212_1017717218 -3 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717218 6:157221436-157221458 CTCCCTTTCCTAGACGGCAGGGG No data
1017717212_1017717216 -5 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717216 6:157221434-157221456 TTCTCCCTTTCCTAGACGGCAGG No data
1017717212_1017717217 -4 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717217 6:157221435-157221457 TCTCCCTTTCCTAGACGGCAGGG No data
1017717212_1017717225 16 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717225 6:157221455-157221477 GGGGCCGATTCAGCCTGGGCGGG No data
1017717212_1017717222 11 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717222 6:157221450-157221472 CGGCAGGGGCCGATTCAGCCTGG No data
1017717212_1017717224 15 Left 1017717212 6:157221416-157221438 CCGCGGCGCCGGCAGCCGTTCTC No data
Right 1017717224 6:157221454-157221476 AGGGGCCGATTCAGCCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017717212 Original CRISPR GAGAACGGCTGCCGGCGCCG CGG (reversed) Intergenic
No off target data available for this crispr