ID: 1017718522

View in Genome Browser
Species Human (GRCh38)
Location 6:157228740-157228762
Sequence GAGGGTGAGGGCGCGTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017718509_1017718522 11 Left 1017718509 6:157228706-157228728 CCAACTGCCCGGGTCTGTGCATG No data
Right 1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG No data
1017718503_1017718522 23 Left 1017718503 6:157228694-157228716 CCCAGCCCAGCACCAACTGCCCG No data
Right 1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG No data
1017718504_1017718522 22 Left 1017718504 6:157228695-157228717 CCAGCCCAGCACCAACTGCCCGG No data
Right 1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG No data
1017718513_1017718522 3 Left 1017718513 6:157228714-157228736 CCGGGTCTGTGCATGGGCCCAGA No data
Right 1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG No data
1017718507_1017718522 18 Left 1017718507 6:157228699-157228721 CCCAGCACCAACTGCCCGGGTCT No data
Right 1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG No data
1017718508_1017718522 17 Left 1017718508 6:157228700-157228722 CCAGCACCAACTGCCCGGGTCTG No data
Right 1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG No data
1017718512_1017718522 4 Left 1017718512 6:157228713-157228735 CCCGGGTCTGTGCATGGGCCCAG No data
Right 1017718522 6:157228740-157228762 GAGGGTGAGGGCGCGTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017718522 Original CRISPR GAGGGTGAGGGCGCGTTCCT GGG Intergenic