ID: 1017720664

View in Genome Browser
Species Human (GRCh38)
Location 6:157241044-157241066
Sequence CCAGGCAGCCAGGTTTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017720649_1017720664 25 Left 1017720649 6:157240996-157241018 CCGGCCAGCTTGGGGTAATTGCT No data
Right 1017720664 6:157241044-157241066 CCAGGCAGCCAGGTTTCCAAGGG No data
1017720650_1017720664 21 Left 1017720650 6:157241000-157241022 CCAGCTTGGGGTAATTGCTGAGG No data
Right 1017720664 6:157241044-157241066 CCAGGCAGCCAGGTTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017720664 Original CRISPR CCAGGCAGCCAGGTTTCCAA GGG Intergenic
No off target data available for this crispr