ID: 1017722406

View in Genome Browser
Species Human (GRCh38)
Location 6:157253133-157253155
Sequence GCATGGACAGCCGTGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017722404_1017722406 -4 Left 1017722404 6:157253114-157253136 CCATGAGGTGACAGGCTTGGCAT No data
Right 1017722406 6:157253133-157253155 GCATGGACAGCCGTGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017722406 Original CRISPR GCATGGACAGCCGTGTGCTG TGG Intergenic
No off target data available for this crispr