ID: 1017723196

View in Genome Browser
Species Human (GRCh38)
Location 6:157258713-157258735
Sequence ACACCCACAGCAGCCAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017723196_1017723200 1 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723200 6:157258737-157258759 GCTGGGTTTTCCCAGCTTCCTGG No data
1017723196_1017723205 17 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723205 6:157258753-157258775 TTCCTGGTGGAGAGTTTCCAGGG No data
1017723196_1017723204 16 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723204 6:157258752-157258774 CTTCCTGGTGGAGAGTTTCCAGG No data
1017723196_1017723208 19 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723208 6:157258755-157258777 CCTGGTGGAGAGTTTCCAGGGGG No data
1017723196_1017723201 4 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723201 6:157258740-157258762 GGGTTTTCCCAGCTTCCTGGTGG No data
1017723196_1017723209 25 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723209 6:157258761-157258783 GGAGAGTTTCCAGGGGGTTGAGG No data
1017723196_1017723206 18 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723206 6:157258754-157258776 TCCTGGTGGAGAGTTTCCAGGGG No data
1017723196_1017723210 26 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017723196 Original CRISPR ACACCCACAGCAGCCAGTCC AGG (reversed) Intergenic
No off target data available for this crispr