ID: 1017723202

View in Genome Browser
Species Human (GRCh38)
Location 6:157258747-157258769
Sequence AAACTCTCCACCAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017723202_1017723212 9 Left 1017723202 6:157258747-157258769 CCCAGCTTCCTGGTGGAGAGTTT No data
Right 1017723212 6:157258779-157258801 TGAGGGAAGAGTCCCCTTCTTGG No data
1017723202_1017723214 14 Left 1017723202 6:157258747-157258769 CCCAGCTTCCTGGTGGAGAGTTT No data
Right 1017723214 6:157258784-157258806 GAAGAGTCCCCTTCTTGGGAAGG No data
1017723202_1017723209 -9 Left 1017723202 6:157258747-157258769 CCCAGCTTCCTGGTGGAGAGTTT No data
Right 1017723209 6:157258761-157258783 GGAGAGTTTCCAGGGGGTTGAGG No data
1017723202_1017723210 -8 Left 1017723202 6:157258747-157258769 CCCAGCTTCCTGGTGGAGAGTTT No data
Right 1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG No data
1017723202_1017723213 10 Left 1017723202 6:157258747-157258769 CCCAGCTTCCTGGTGGAGAGTTT No data
Right 1017723213 6:157258780-157258802 GAGGGAAGAGTCCCCTTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017723202 Original CRISPR AAACTCTCCACCAGGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr