ID: 1017723208

View in Genome Browser
Species Human (GRCh38)
Location 6:157258755-157258777
Sequence CCTGGTGGAGAGTTTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017723196_1017723208 19 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723208 6:157258755-157258777 CCTGGTGGAGAGTTTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017723208 Original CRISPR CCTGGTGGAGAGTTTCCAGG GGG Intergenic
No off target data available for this crispr