ID: 1017723209

View in Genome Browser
Species Human (GRCh38)
Location 6:157258761-157258783
Sequence GGAGAGTTTCCAGGGGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017723203_1017723209 -10 Left 1017723203 6:157258748-157258770 CCAGCTTCCTGGTGGAGAGTTTC No data
Right 1017723209 6:157258761-157258783 GGAGAGTTTCCAGGGGGTTGAGG No data
1017723196_1017723209 25 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723209 6:157258761-157258783 GGAGAGTTTCCAGGGGGTTGAGG No data
1017723202_1017723209 -9 Left 1017723202 6:157258747-157258769 CCCAGCTTCCTGGTGGAGAGTTT No data
Right 1017723209 6:157258761-157258783 GGAGAGTTTCCAGGGGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017723209 Original CRISPR GGAGAGTTTCCAGGGGGTTG AGG Intergenic
No off target data available for this crispr