ID: 1017723210

View in Genome Browser
Species Human (GRCh38)
Location 6:157258762-157258784
Sequence GAGAGTTTCCAGGGGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017723202_1017723210 -8 Left 1017723202 6:157258747-157258769 CCCAGCTTCCTGGTGGAGAGTTT No data
Right 1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG No data
1017723196_1017723210 26 Left 1017723196 6:157258713-157258735 CCTGGACTGGCTGCTGTGGGTGT No data
Right 1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG No data
1017723203_1017723210 -9 Left 1017723203 6:157258748-157258770 CCAGCTTCCTGGTGGAGAGTTTC No data
Right 1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017723210 Original CRISPR GAGAGTTTCCAGGGGGTTGA GGG Intergenic
No off target data available for this crispr