ID: 1017724551

View in Genome Browser
Species Human (GRCh38)
Location 6:157267902-157267924
Sequence CTCTGCCGGCTGGGGAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017724540_1017724551 15 Left 1017724540 6:157267864-157267886 CCTGGATGTTCAAAGCCAGCACC No data
Right 1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG No data
1017724539_1017724551 16 Left 1017724539 6:157267863-157267885 CCCTGGATGTTCAAAGCCAGCAC No data
Right 1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG No data
1017724545_1017724551 -6 Left 1017724545 6:157267885-157267907 CCGTGGAGCTGGGCAGCCTCTGC No data
Right 1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG No data
1017724544_1017724551 0 Left 1017724544 6:157267879-157267901 CCAGCACCGTGGAGCTGGGCAGC No data
Right 1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG No data
1017724538_1017724551 30 Left 1017724538 6:157267849-157267871 CCTGGGCAACAGAGCCCTGGATG No data
Right 1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017724551 Original CRISPR CTCTGCCGGCTGGGGAGTTC TGG Intergenic
No off target data available for this crispr