ID: 1017725532

View in Genome Browser
Species Human (GRCh38)
Location 6:157274069-157274091
Sequence CTATAGTTATTGATGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017725527_1017725532 21 Left 1017725527 6:157274025-157274047 CCACACGCAGAGGGGAAAATGTG No data
Right 1017725532 6:157274069-157274091 CTATAGTTATTGATGGAAGCTGG No data
1017725526_1017725532 22 Left 1017725526 6:157274024-157274046 CCCACACGCAGAGGGGAAAATGT No data
Right 1017725532 6:157274069-157274091 CTATAGTTATTGATGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017725532 Original CRISPR CTATAGTTATTGATGGAAGC TGG Intergenic
No off target data available for this crispr