ID: 1017726186

View in Genome Browser
Species Human (GRCh38)
Location 6:157277459-157277481
Sequence GAGTGGGACCAGAGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017726186_1017726192 3 Left 1017726186 6:157277459-157277481 CCTTCTCTCCTCTGGTCCCACTC No data
Right 1017726192 6:157277485-157277507 GCAGACAATAAGGAATGACATGG No data
1017726186_1017726190 -7 Left 1017726186 6:157277459-157277481 CCTTCTCTCCTCTGGTCCCACTC No data
Right 1017726190 6:157277475-157277497 CCCACTCATGGCAGACAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017726186 Original CRISPR GAGTGGGACCAGAGGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr