ID: 1017729480

View in Genome Browser
Species Human (GRCh38)
Location 6:157302338-157302360
Sequence CTGGTGAAAGGAATCATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017729480_1017729484 23 Left 1017729480 6:157302338-157302360 CCTATAATGATTCCTTTCACCAG 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1017729484 6:157302384-157302406 GTTGTTGAACATGAAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017729480 Original CRISPR CTGGTGAAAGGAATCATTAT AGG (reversed) Intronic
901949961 1:12736050-12736072 CTGGAGGAAGGAAACATTCTAGG + Intergenic
903220743 1:21868450-21868472 ATGGTGACAGGAATGATAATGGG + Intronic
905526862 1:38646508-38646530 CTGGTGTTAGGAATCATCAATGG + Intergenic
906977431 1:50590679-50590701 ATGGTGAAAGGGGTCATTCTTGG + Intronic
913972702 1:143426477-143426499 CTGCTGAAAGAAATCATAGTTGG - Intergenic
914067086 1:144252091-144252113 CTGCTGAAAGAAATCATAGTTGG - Intergenic
914112067 1:144714263-144714285 CTGCTGAAAGAAATCATAGTTGG + Intergenic
914321661 1:146568654-146568676 GTGGTGAAAAAAATCAATATTGG + Intergenic
918182862 1:182100208-182100230 CTGATGAAAGAAATCATAAATGG - Intergenic
919141863 1:193582393-193582415 CAGGTAAAACCAATCATTATTGG + Intergenic
920158588 1:203977182-203977204 CTGGTGCAAGGAATAATTTGGGG + Intergenic
920915265 1:210253443-210253465 CTGGGGAAAGGAGTAACTATAGG + Intergenic
921597683 1:217072642-217072664 CTGCTCAAAAGAATCATTATAGG - Intronic
921871504 1:220145685-220145707 CTGGAGAATTGAATAATTATAGG + Intronic
923123718 1:231017480-231017502 TTTGTGAAAGGAATCATCAGAGG + Intergenic
923160875 1:231313607-231313629 CTTGTTAAAGGACTCATTATTGG - Intergenic
1063917106 10:10894319-10894341 CTGGTGAGAGGATTCATCATCGG - Intergenic
1064604808 10:17027829-17027851 ATGATAAAAGGAAGCATTATAGG - Intronic
1065108817 10:22419622-22419644 CTGGTAAATGTAATAATTATAGG - Intronic
1071771570 10:88734711-88734733 CTGATGAGAAGAATGATTATGGG + Intronic
1072655928 10:97330517-97330539 ATGGTGAAAGGAATTATTGGTGG - Intergenic
1073956394 10:108876490-108876512 CTAGAGACAGGAAACATTATGGG + Intergenic
1074191759 10:111144211-111144233 CTGATAAGAGGAAACATTATAGG - Intergenic
1074882018 10:117666984-117667006 CTGGTGATAATAATCATTACAGG - Intergenic
1081827281 11:46068229-46068251 CTGGTGAAAGGCATGATACTAGG - Intronic
1081936771 11:46909921-46909943 CTGGTGAAAGGAACTCTTGTAGG - Intronic
1086175955 11:83891211-83891233 TTAGTGATAGGAAACATTATAGG + Intronic
1091097917 11:132841302-132841324 TTAGTGAAAGGAATAATTAGTGG - Intronic
1091297331 11:134483159-134483181 CTGGTGAAAGGAAGCTTTGATGG - Intergenic
1092548594 12:9473118-9473140 CTGGTGAAATGCCTCCTTATTGG + Intergenic
1093338167 12:17935701-17935723 ATGGAGAATGGAATTATTATTGG - Intergenic
1093657613 12:21714806-21714828 CTCCTGAAAGAAGTCATTATGGG - Intronic
1099148101 12:79073511-79073533 CTGCTGAAATGCTTCATTATTGG - Intronic
1100956166 12:99911105-99911127 GTGGTGAAATAAATCATTCTCGG + Intronic
1101841358 12:108329613-108329635 ATGATGAATGGAATCATCATGGG + Intronic
1106648203 13:31659950-31659972 CTGCTGAAAGGAATTATAAATGG - Intergenic
1107547963 13:41451653-41451675 CTTGTGAAATTATTCATTATAGG - Intergenic
1108087062 13:46804560-46804582 CTGGGGAATGGAATCATTGGTGG + Intergenic
1109348779 13:61148935-61148957 CTATTGAAAGGACTTATTATAGG + Intergenic
1110911300 13:80968134-80968156 CTGGTTATAGTCATCATTATAGG + Intergenic
1114354570 14:21893146-21893168 CTTGTGAAAAGAATCCTTGTTGG + Intergenic
1115676747 14:35684676-35684698 CAGGTGCAAGGCATCATTCTTGG - Intronic
1117114299 14:52494038-52494060 CTGGTGATAGGAATCACTTTGGG - Intronic
1117595258 14:57320697-57320719 CTGGAGAAGGGAATCATATTTGG + Intergenic
1121301637 14:92876342-92876364 CTGGTGAAATAAATGATGATAGG - Intergenic
1121808091 14:96850169-96850191 CTCTTAAAAAGAATCATTATAGG + Intronic
1128516306 15:68344125-68344147 CTGGTGGCAGGAATCATTTCTGG - Intronic
1129071374 15:72954150-72954172 CTGGTGCTAGGCATCATCATGGG - Intergenic
1132332165 15:101020155-101020177 CTGGGGAAAGGAATTACTAGAGG - Intronic
1135716701 16:24776632-24776654 CTGGTCAAAGACATCATCATCGG - Intronic
1136946940 16:34663714-34663736 GACGTGAATGGAATCATTATCGG - Intergenic
1137600771 16:49754748-49754770 ATGAGGAAAGCAATCATTATGGG + Intronic
1139167454 16:64584169-64584191 CTGGTGAAAAGTACCATTAAAGG + Intergenic
1139237543 16:65355819-65355841 CTGTTTAATGGAATCATTGTTGG - Intergenic
1140428414 16:74880698-74880720 GAGGTGAAATGAATCATTCTTGG + Intronic
1141803533 16:86327191-86327213 CTGGTGAAAAGAATCCTAAGAGG + Intergenic
1144299991 17:13914218-13914240 CTGGTTAAAAGAGTTATTATCGG - Intergenic
1146474118 17:33148412-33148434 TAGGTGAAAGGAATCATGGTAGG - Intronic
1146694548 17:34898568-34898590 CTGGTTCAAGGACTCCTTATGGG - Intergenic
1147043827 17:37738327-37738349 CTGGTGAAAGGAATGGTTTTAGG - Intronic
1147482997 17:40784988-40785010 CTTCTGAAAGTAATAATTATAGG - Intergenic
1153094759 18:1388182-1388204 ATGGGGAAAGGATTCCTTATTGG + Intergenic
1156803087 18:41142452-41142474 CTGCTGCTAAGAATCATTATTGG + Intergenic
1157783374 18:50459867-50459889 CTGCTGAGAGGATTCAGTATGGG + Intergenic
1159026905 18:63191602-63191624 CTGGTGAAATCACTCATTGTAGG + Intronic
1165177670 19:33941946-33941968 CTGGTGAAAGGAAGCATCCAGGG - Intergenic
925963044 2:9036374-9036396 CTTGTGAAAGGAGAGATTATTGG + Intergenic
929197690 2:39202990-39203012 ATGGCAAAAGGTATCATTATTGG + Intronic
930197899 2:48527935-48527957 CTGGTGAAAGAAATCTCTTTTGG - Intergenic
932120331 2:69093255-69093277 TTGGTGAAAGGAATTAATAAGGG - Intronic
934177396 2:89587440-89587462 CTGCTGAAAGAAATCATAGTTGG - Intergenic
934287695 2:91661751-91661773 CTGCTGAAAGAAATCATAGTTGG - Intergenic
936525768 2:113240646-113240668 CAGGTGAAATGAATCATAACAGG - Intronic
936856854 2:116968635-116968657 TTGATCAAAGGAATCATTAAAGG - Intergenic
937088441 2:119187710-119187732 CTGTTGACTGGAATCCTTATGGG + Intergenic
937673274 2:124561330-124561352 CTGGAGAAAGAAATCCTTACTGG + Intronic
940449810 2:153823105-153823127 CTGCTGAAAGAAATCATAAATGG + Intergenic
942325034 2:174769300-174769322 AAGGTCAAAGGAATCAGTATGGG + Intergenic
943382268 2:187165960-187165982 CTGGGGAAAGAAAACATTTTTGG - Intergenic
947997253 2:234538657-234538679 CTGGTGATAGGAACCAAGATAGG - Intergenic
948732463 2:239975742-239975764 CTGGTGGAAGGAAGGATTATGGG - Intronic
1170044184 20:12067904-12067926 CTGATGAAAGGAATCTCTATAGG - Intergenic
1177155054 21:17493087-17493109 CTAGTAAAATGAACCATTATTGG - Intergenic
1178159093 21:29890479-29890501 CTGGTTGAGGGAGTCATTATTGG - Intronic
949812972 3:8027396-8027418 CTGGTAAAATGTATCATTAGAGG + Intergenic
949972747 3:9424946-9424968 CTGATGAAAGCAACCATAATAGG - Intronic
950848137 3:16034834-16034856 CTGGTGGAAGGAAGCAGGATTGG - Intergenic
953232053 3:41074130-41074152 CTGGTGAAGGGAGTCATTCTGGG - Intergenic
954884133 3:53857207-53857229 CTAGTGAAAGGAGTCCTTTTGGG + Intronic
955763026 3:62309774-62309796 ATGGTGAAAGGAATTGTTTTTGG + Intergenic
956632133 3:71327191-71327213 CTTGTGAAGGGAATCATTTGAGG + Intronic
956660987 3:71597128-71597150 TTGATGAATGGAATCATTGTTGG - Intergenic
957290284 3:78269807-78269829 TTGGTTAAAGGAATGGTTATTGG + Intergenic
958130168 3:89408734-89408756 CTGGTGAAACGAATCATTCCAGG + Intronic
959467482 3:106705897-106705919 ATGGTGAAAAAAATCATTTTTGG - Intergenic
959832945 3:110886053-110886075 CTTGTGAAAGTACTCAGTATTGG - Intergenic
960741228 3:120835862-120835884 AGGGTGAAAGGAAGCATAATTGG - Intergenic
964037737 3:152218811-152218833 ATGATGAAAGAAAGCATTATAGG - Intergenic
964659284 3:159102103-159102125 TTTGTAAAAGGAATCATTTTAGG - Intronic
966024865 3:175265631-175265653 CTTTTGGAAGGAAACATTATTGG + Intronic
967043550 3:185716257-185716279 CTGGGCAGAGGAATCATTGTCGG - Intronic
970083641 4:12320194-12320216 CTGGGCAAAGGAAACATTAGTGG - Intergenic
972776153 4:42242730-42242752 CAGGTGAAATGAATTATAATAGG + Intergenic
972854032 4:43084039-43084061 CTGCTGAAAGGAATCATAGATGG - Intergenic
976870293 4:89784378-89784400 GTGTTGGAAGGGATCATTATAGG - Intronic
978979134 4:114919950-114919972 CTGGTGAAAGGAATATCTCTTGG + Intronic
981316018 4:143340230-143340252 CTGGATAAAGGAAACATTGTTGG + Intronic
981526340 4:145709902-145709924 CAGCTGAGAGGAATCATTCTGGG + Intronic
981598696 4:146458612-146458634 ATGGTGAAAGTAATTGTTATTGG + Intronic
982392037 4:154875251-154875273 CTGAAGAAAGGAATGATGATGGG + Intergenic
983765916 4:171483598-171483620 CTTCTGTATGGAATCATTATGGG - Intergenic
984824389 4:183911454-183911476 CTGATGAAAGGAGTCAACATAGG - Intronic
987270296 5:16301225-16301247 CTGGTCAAAGGAATCATGTAAGG + Intergenic
990056592 5:51588162-51588184 TTGGAAAAAGGAAACATTATTGG + Intergenic
992379745 5:76225529-76225551 GTGATGAAAGGAAACAGTATGGG + Intronic
993072276 5:83180004-83180026 CTGGTGCAAGGAATAGTTAAAGG + Intronic
993191662 5:84690849-84690871 CTGGGGGAAGGAATCACTTTAGG - Intergenic
994640938 5:102409023-102409045 CGGCTGAAAGGAATCAGTCTTGG + Intronic
995350252 5:111166673-111166695 ATGCTAAAAGGAATCATCATAGG + Intergenic
995592887 5:113717905-113717927 GTGGGGAAAGGAAACATGATAGG - Intergenic
996674825 5:126162353-126162375 CTGGTGAAAGAAAACATTAACGG + Intergenic
997310139 5:132873006-132873028 CAGGTGAATTGAATAATTATAGG - Exonic
998215124 5:140232168-140232190 CAAGAGAAAGGAATCATGATTGG + Intronic
1000234840 5:159347811-159347833 CTGGAGAACTAAATCATTATTGG - Intergenic
1009690561 6:67027087-67027109 CTGGGGACAGGAATAATTTTGGG - Intergenic
1010919302 6:81662109-81662131 CTTGTTAAGGGAATCATAATGGG + Intronic
1011765966 6:90620080-90620102 ATTGTGAAAGCAATCATTGTGGG - Intergenic
1013095571 6:106941665-106941687 CTGGTGGAAAGAATTCTTATGGG + Intergenic
1016194404 6:141315823-141315845 GTAATGAAAGGAAGCATTATAGG + Intergenic
1017362218 6:153587903-153587925 CAGGTGAAATGAACCCTTATAGG - Intergenic
1017635267 6:156436978-156437000 CTTATGAAATGAATCATAATTGG - Intergenic
1017729480 6:157302338-157302360 CTGGTGAAAGGAATCATTATAGG - Intronic
1018411357 6:163552021-163552043 CTGTTGACAGGAAGCATTACTGG + Intronic
1019290786 7:249079-249101 CTGGTGAAACGATTCACTTTTGG + Intronic
1021195507 7:17670197-17670219 CTACTAGAAGGAATCATTATTGG + Intergenic
1022066010 7:26858316-26858338 CTGGTGAAAGTAAACGTGATGGG + Intronic
1023235119 7:38077866-38077888 GTGGTGAAAGGAAGCATCCTTGG - Intergenic
1023689122 7:42768052-42768074 CTGGAGAAGGGAATCCTTAAGGG + Intergenic
1028994167 7:97081614-97081636 GTGGTAAAAGAAATCATGATTGG - Intergenic
1030721679 7:112878594-112878616 CTGGTGAAGGGAATAAGTAATGG + Intronic
1030915835 7:115312056-115312078 ATGGAGAAAGGTATAATTATGGG - Intergenic
1033008684 7:137595551-137595573 CTTGTGAAATGTATAATTATGGG - Intronic
1033355732 7:140597871-140597893 CTGGAGAAAGGATTTATTATTGG + Intronic
1035591679 8:820374-820396 CTGTTGAAAGATATCATTAATGG + Intergenic
1037107656 8:15129064-15129086 GTGGTGAAAGGGATGATTATAGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1044195351 8:89370370-89370392 ATGCTTAAAGGAATAATTATAGG + Intergenic
1047568032 8:126067603-126067625 CTTGTAAAACAAATCATTATTGG + Intergenic
1047895981 8:129366854-129366876 GTGTTGAAAGGATGCATTATGGG - Intergenic
1047904667 8:129460133-129460155 CTGGAGAAAGCACTCTTTATAGG + Intergenic
1048670324 8:136712155-136712177 CTGGGGAAAGGATGCATTCTTGG + Intergenic
1050147006 9:2579446-2579468 CTGCAGAAAGAAATTATTATAGG + Intergenic
1051556152 9:18384702-18384724 CTGGTAAAAGGAATCCTATTGGG - Intergenic
1053945616 9:43307489-43307511 CTGGTGATAGCAATAATGATTGG + Intergenic
1054258714 9:62840284-62840306 CTGCTGAAAGGAATCATAGATGG - Intergenic
1055020703 9:71666455-71666477 ATGGTGAAAGGACTAATTAGGGG - Intergenic
1203588751 Un_KI270747v1:36069-36091 CTGGTGATAGCAATAATGATTGG + Intergenic
1189078247 X:37940870-37940892 CCAGTGAAAGAAATCATTCTTGG + Intronic
1190658148 X:52630405-52630427 CTGGTAAGAGGAATCAATTTGGG + Intergenic
1191053306 X:56217274-56217296 ATGGTAAAAGGGCTCATTATTGG + Intergenic
1193606508 X:83575219-83575241 CTAATGCCAGGAATCATTATAGG + Intergenic
1195319614 X:103711027-103711049 CTGGTGAAAGGACTCTGGATTGG + Exonic
1195745488 X:108113287-108113309 TTGGTGACAGGAAGCATTTTAGG + Intronic
1197045589 X:121993763-121993785 CTGGAGAAAGGAATCCTTCTGGG - Intergenic
1197301989 X:124792153-124792175 CTGGGGAAAGGAAGGAGTATGGG - Intronic
1198155960 X:133961131-133961153 CTGGCGAAAGAAATCATCTTAGG + Intronic
1201281542 Y:12347061-12347083 CTGGTGAATGGCATCTTCATAGG - Intergenic