ID: 1017731337

View in Genome Browser
Species Human (GRCh38)
Location 6:157319517-157319539
Sequence CTGAATAAACAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1404
Summary {0: 1, 1: 0, 2: 5, 3: 64, 4: 632}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017731337 Original CRISPR CTGAATAAACAGAAAGAGGA AGG (reversed) Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
900986170 1:6073887-6073909 CTCACAAAACAGAAAGAGGGAGG - Intronic
900986170 1:6073887-6073909 CTCACAAAACAGAAAGAGGGAGG - Intronic
902117242 1:14131672-14131694 CTCAATTAACTGAAAGTGGAGGG - Intergenic
902117242 1:14131672-14131694 CTCAATTAACTGAAAGTGGAGGG - Intergenic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
902173736 1:14633729-14633751 CTGAATCCTCAGAGAGAGGATGG - Intronic
902407487 1:16193000-16193022 CTCAAAAAACAGAAAGATGGGGG + Intergenic
902407487 1:16193000-16193022 CTCAAAAAACAGAAAGATGGGGG + Intergenic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903187719 1:21638572-21638594 TTGTTTAAAGAGAAAGAGGACGG - Intronic
903187719 1:21638572-21638594 TTGTTTAAAGAGAAAGAGGACGG - Intronic
903623330 1:24713864-24713886 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
903623330 1:24713864-24713886 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
903768467 1:25749503-25749525 CTGATTAAACAGGGAGCGGAGGG - Intronic
903768467 1:25749503-25749525 CTGATTAAACAGGGAGCGGAGGG - Intronic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904354252 1:29928377-29928399 CAGAATAAAAAGGCAGAGGAAGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905737157 1:40337463-40337485 TTGAATAAAAAGGCAGAGGAAGG + Intergenic
905737157 1:40337463-40337485 TTGAATAAAAAGGCAGAGGAAGG + Intergenic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
906814872 1:48868326-48868348 CTGCTTAAGCAGAAAGGGGAAGG + Intronic
908562512 1:65320878-65320900 CTGAAGAAACAGAAACAAGCAGG + Intronic
908562512 1:65320878-65320900 CTGAAGAAACAGAAACAAGCAGG + Intronic
908761532 1:67517205-67517227 CTAAATGGAAAGAAAGAGGAAGG + Intergenic
908761532 1:67517205-67517227 CTAAATGGAAAGAAAGAGGAAGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
908997261 1:70170221-70170243 CTCAAAAACCAGAAAGAGAAGGG + Intronic
908997261 1:70170221-70170243 CTCAAAAACCAGAAAGAGAAGGG + Intronic
910501599 1:87898029-87898051 GTGGATAAATAGAAAGAGTAAGG + Intergenic
910501599 1:87898029-87898051 GTGGATAAATAGAAAGAGTAAGG + Intergenic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
911042460 1:93601743-93601765 TTGAATAAAGAAAAAGAAGAAGG + Intronic
911042460 1:93601743-93601765 TTGAATAAAGAAAAAGAAGAAGG + Intronic
912024490 1:105150770-105150792 CTGAACAAAAAGAAAGAATATGG + Intergenic
912024490 1:105150770-105150792 CTGAACAAAAAGAAAGAATATGG + Intergenic
912659170 1:111513298-111513320 CTGAATAAACAGCAACAAGTGGG + Intronic
912659170 1:111513298-111513320 CTGAATAAACAGCAACAAGTGGG + Intronic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
914248020 1:145900250-145900272 ATAAATAAAAAGAAAGAGCAAGG - Intronic
914248020 1:145900250-145900272 ATAAATAAAAAGAAAGAGCAAGG - Intronic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
914920793 1:151846208-151846230 CTGGAAATACAGAAAGAGGTGGG - Intergenic
916235098 1:162579076-162579098 CTGAATAAACAGGAAGAAAAGGG - Intronic
916235098 1:162579076-162579098 CTGAATAAACAGGAAGAAAAGGG - Intronic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
916517233 1:165530887-165530909 TGGAAGAAACAGAAAGAGTATGG + Intergenic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917316868 1:173735096-173735118 GTGATTACACAGAAAGAAGAGGG + Intronic
917316868 1:173735096-173735118 GTGATTACACAGAAAGAAGAGGG + Intronic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919507352 1:198416131-198416153 CTGAAAAAACAAAAAGGGGAAGG + Intergenic
919507352 1:198416131-198416153 CTGAAAAAACAAAAAGGGGAAGG + Intergenic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
921482885 1:215683711-215683733 GTGAATAAGAAGAAAGAGAAAGG - Intronic
921487012 1:215726989-215727011 TGGAATATACAGAAACAGGATGG - Intronic
921487012 1:215726989-215727011 TGGAATATACAGAAACAGGATGG - Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922133544 1:222802640-222802662 AGGAATACACAGGAAGAGGAAGG + Intergenic
922133544 1:222802640-222802662 AGGAATACACAGGAAGAGGAAGG + Intergenic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922593108 1:226793505-226793527 CTTTAAAAACAGAAAGAGGCCGG + Intergenic
922953383 1:229578346-229578368 CGGAAGGAAAAGAAAGAGGAAGG - Intergenic
922953383 1:229578346-229578368 CGGAAGGAAAAGAAAGAGGAAGG - Intergenic
923351788 1:233114614-233114636 CTGGATAAACAGAAAACTGATGG + Intronic
923351788 1:233114614-233114636 CTGGATAAACAGAAAACTGATGG + Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
923746820 1:236708878-236708900 CTGACTAAAGTGGAAGAGGAAGG - Intronic
923746820 1:236708878-236708900 CTGACTAAAGTGGAAGAGGAAGG - Intronic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924222839 1:241895880-241895902 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924223070 1:241898131-241898153 CTGAATAATAAGAATGTGGAAGG - Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
924622255 1:245672341-245672363 CTGACTAAACAGAAAGGCCACGG + Intronic
924622255 1:245672341-245672363 CTGACTAAACAGAAAGGCCACGG + Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063977519 10:11429225-11429247 CTGATGAAACAGAAATGGGAGGG + Intergenic
1063977519 10:11429225-11429247 CTGATGAAACAGAAATGGGAGGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064107877 10:12515608-12515630 CTCAAAAAAAAAAAAGAGGAAGG - Intronic
1064107877 10:12515608-12515630 CTCAAAAAAAAAAAAGAGGAAGG - Intronic
1064867548 10:19898135-19898157 CTCAATAAATACAAAGAAGAGGG + Intronic
1064867548 10:19898135-19898157 CTCAATAAATACAAAGAAGAGGG + Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065012416 10:21431597-21431619 CTCAAAAAAAAGAAAAAGGAAGG - Intergenic
1065012416 10:21431597-21431619 CTCAAAAAAAAGAAAAAGGAAGG - Intergenic
1065251974 10:23824285-23824307 ATAAATAAATAAAAAGAGGAGGG + Intronic
1065251974 10:23824285-23824307 ATAAATAAATAAAAAGAGGAGGG + Intronic
1065429337 10:25637928-25637950 CTTAATATACAGAAATAGGCCGG + Intergenic
1065429337 10:25637928-25637950 CTTAATATACAGAAATAGGCCGG + Intergenic
1065516092 10:26525771-26525793 CTGAAGAAACAGGAAGAAGTGGG + Intronic
1065516092 10:26525771-26525793 CTGAAGAAACAGGAAGAAGTGGG + Intronic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1066664956 10:37773659-37773681 GTGAAGAGACAGTAAGAGGATGG - Intergenic
1066991318 10:42516832-42516854 GGGAATCAAAAGAAAGAGGAAGG + Intergenic
1066991318 10:42516832-42516854 GGGAATCAAAAGAAAGAGGAAGG + Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067740700 10:48894158-48894180 CTGAATAGCCATATAGAGGATGG - Intronic
1067740700 10:48894158-48894180 CTGAATAGCCATATAGAGGATGG - Intronic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068585693 10:58795972-58795994 GTGAAGAGACAGCAAGAGGATGG - Intronic
1068643478 10:59438082-59438104 CTGAATGAATAGGAAGAGAAAGG - Intergenic
1068643478 10:59438082-59438104 CTGAATGAATAGGAAGAGAAAGG - Intergenic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1068906393 10:62329010-62329032 GTGACTACACAGAAAGAAGATGG - Intergenic
1068906393 10:62329010-62329032 GTGACTACACAGAAAGAAGATGG - Intergenic
1069124287 10:64609830-64609852 ATGAAAACAAAGAAAGAGGAAGG - Intergenic
1069124287 10:64609830-64609852 ATGAAAACAAAGAAAGAGGAAGG - Intergenic
1069906888 10:71737273-71737295 CTGAGCAAACAGAAAGTGAAGGG - Intronic
1069906888 10:71737273-71737295 CTGAGCAAACAGAAAGTGAAGGG - Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070408894 10:76121221-76121243 GTGAGTAGAAAGAAAGAGGAAGG + Intronic
1070408894 10:76121221-76121243 GTGAGTAGAAAGAAAGAGGAAGG + Intronic
1070694987 10:78556015-78556037 CTGAATAAAGGTAAAGATGAAGG - Intergenic
1070694987 10:78556015-78556037 CTGAATAAAGGTAAAGATGAAGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071188621 10:83074989-83075011 CTGAATAAACACCATGAAGATGG + Intergenic
1071188621 10:83074989-83075011 CTGAATAAACACCATGAAGATGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1072064563 10:91853412-91853434 TTGAATGAACATAAAGAAGATGG - Intronic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073075638 10:100824625-100824647 CTGGAAAAACACAAAGGGGAAGG - Intronic
1073234767 10:102004725-102004747 CTGAATAAACAGAGACAAGTAGG + Intronic
1073234767 10:102004725-102004747 CTGAATAAACAGAGACAAGTAGG + Intronic
1073787752 10:106908884-106908906 CTGAAGAAACAGAAATTGGGTGG - Intronic
1073787752 10:106908884-106908906 CTGAAGAAACAGAAATTGGGTGG - Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074416017 10:113267364-113267386 CTGAATAAACTGAAACAGGAAGG - Intergenic
1074416017 10:113267364-113267386 CTGAATAAACTGAAACAGGAAGG - Intergenic
1074915894 10:117954564-117954586 TGGAATAAAGAGAAAAAGGAAGG - Intergenic
1074915894 10:117954564-117954586 TGGAATAAAGAGAAAAAGGAAGG - Intergenic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1076023855 10:127096144-127096166 CAGAACAAAAAGAAAGACGATGG - Intronic
1076023855 10:127096144-127096166 CAGAACAAAAAGAAAGACGATGG - Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076030137 10:127150336-127150358 CTGAGCAAAGAGAAAGGGGAGGG - Intronic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079719133 11:23788783-23788805 CATAATAAAGAAAAAGAGGAAGG + Intergenic
1079719133 11:23788783-23788805 CATAATAAAGAAAAAGAGGAAGG + Intergenic
1080027327 11:27628232-27628254 CTGCATAAAGATACAGAGGAAGG - Intergenic
1080027327 11:27628232-27628254 CTGCATAAAGATACAGAGGAAGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1080709628 11:34734389-34734411 CTGAGCATGCAGAAAGAGGATGG - Intergenic
1081797529 11:45831722-45831744 CTGAAGAAAATGAAACAGGATGG + Intergenic
1081797529 11:45831722-45831744 CTGAAGAAAATGAAACAGGATGG + Intergenic
1082045517 11:47722985-47723007 CTGAAAAGACAAAAAAAGGAAGG - Exonic
1082045517 11:47722985-47723007 CTGAAAAGACAAAAAAAGGAAGG - Exonic
1082995758 11:59253957-59253979 ATTAATCAAAAGAAAGAGGATGG - Intergenic
1082995758 11:59253957-59253979 ATTAATCAAAAGAAAGAGGATGG - Intergenic
1083039734 11:59673861-59673883 CTGAAATTACATAAAGAGGAAGG + Intergenic
1083039734 11:59673861-59673883 CTGAAATTACATAAAGAGGAAGG + Intergenic
1083230897 11:61318226-61318248 CTGAATAAATATAATGAGAAGGG - Intronic
1083230897 11:61318226-61318248 CTGAATAAATATAATGAGAAGGG - Intronic
1083506512 11:63162862-63162884 CTGATTAAACAGCAAGATAAAGG - Intronic
1083506512 11:63162862-63162884 CTGATTAAACAGCAAGATAAAGG - Intronic
1083908413 11:65689727-65689749 ATAAATAAATAAAAAGAGGAAGG + Intergenic
1083908413 11:65689727-65689749 ATAAATAAATAAAAAGAGGAAGG + Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1084493925 11:69492918-69492940 CTGAAAAAAGAGAAAGTGGCTGG + Intergenic
1085079805 11:73624804-73624826 CTCAAAAAACACAAAAAGGAAGG - Intergenic
1085079805 11:73624804-73624826 CTCAAAAAACACAAAAAGGAAGG - Intergenic
1085466293 11:76725855-76725877 CTGAATCAACGGACAGAGAAGGG - Intergenic
1085466293 11:76725855-76725877 CTGAATCAACGGACAGAGAAGGG - Intergenic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087087138 11:94231278-94231300 CCGAATGAAGAGAAAAAGGAAGG + Intergenic
1087087138 11:94231278-94231300 CCGAATGAAGAGAAAAAGGAAGG + Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1089141128 11:116285213-116285235 GTGAATAAACGGAAAGTGGCTGG - Intergenic
1089141128 11:116285213-116285235 GTGAATAAACGGAAAGTGGCTGG - Intergenic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1090822891 11:130360790-130360812 CTGAAAACACAGTAAAAGGATGG - Intergenic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1091533474 12:1383229-1383251 CAGAAGAAACAGGGAGAGGAGGG - Intronic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093262617 12:16957719-16957741 CTGAGTACACAGTAAGAAGATGG + Intergenic
1093262617 12:16957719-16957741 CTGAGTACACAGTAAGAAGATGG + Intergenic
1093799470 12:23355704-23355726 CTAAAGAGACAGAAATAGGAGGG - Intergenic
1093799470 12:23355704-23355726 CTAAAGAGACAGAAATAGGAGGG - Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094273946 12:28647119-28647141 ATTAATAAATAGCAAGAGGAAGG - Intergenic
1094273946 12:28647119-28647141 ATTAATAAATAGCAAGAGGAAGG - Intergenic
1094386400 12:29898600-29898622 CTTAATAAACAAAAAGGGGGAGG + Intergenic
1094386400 12:29898600-29898622 CTTAATAAACAAAAAGGGGGAGG + Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1095378503 12:41560111-41560133 CGGAAAAAACAGAAATAGGGAGG - Intronic
1095378503 12:41560111-41560133 CGGAAAAAACAGAAATAGGGAGG - Intronic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095541481 12:43313339-43313361 TTGAAGAAAAAGGAAGAGGAGGG - Intergenic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1095772027 12:45970371-45970393 CTGGTTACACAGAAAGAAGAGGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096438544 12:51617835-51617857 TGGAATAAACAGAAATAGAATGG - Intronic
1096438544 12:51617835-51617857 TGGAATAAACAGAAATAGAATGG - Intronic
1096697369 12:53358383-53358405 CTCAAAAAACAGAAAAAGGCAGG + Intergenic
1096697369 12:53358383-53358405 CTCAAAAAACAGAAAAAGGCAGG + Intergenic
1096923692 12:55117972-55117994 CTAAATAAAGAGAAAAATGAGGG + Intergenic
1096923692 12:55117972-55117994 CTAAATAAAGAGAAAAATGAGGG + Intergenic
1096987332 12:55768722-55768744 CTCAAAAAAAAGAAAGAGGCTGG - Intronic
1096987332 12:55768722-55768744 CTCAAAAAAAAGAAAGAGGCTGG - Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1097680561 12:62645269-62645291 CTGAGAACACAGTAAGAGGAGGG + Exonic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1097981100 12:65738828-65738850 CTTAAAAAAAAGAAAGAGGGAGG - Intergenic
1097981100 12:65738828-65738850 CTTAAAAAAAAGAAAGAGGGAGG - Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098796257 12:74891958-74891980 ATGAATAAAAATAAAGAAGAAGG + Intergenic
1098796257 12:74891958-74891980 ATGAATAAAAATAAAGAAGAAGG + Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1098957722 12:76704826-76704848 CTGAGCAAACAGAAAGATGAAGG - Intergenic
1099381594 12:81960670-81960692 CGGAATAAAAAGAAACAGCAAGG - Intergenic
1099381594 12:81960670-81960692 CGGAATAAAAAGAAACAGCAAGG - Intergenic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1099795283 12:87392699-87392721 CTGAAAAAAAAGGAAGAAGAAGG + Intergenic
1099795283 12:87392699-87392721 CTGAAAAAAAAGGAAGAAGAAGG + Intergenic
1099851629 12:88105346-88105368 CTTAAAAAAGAGAAAGCGGAGGG + Intronic
1099851629 12:88105346-88105368 CTTAAAAAAGAGAAAGCGGAGGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100122825 12:91388613-91388635 CTGTACAAACACAAGGAGGAAGG + Intergenic
1100641486 12:96485721-96485743 CTCAAAAAAAAGAGAGAGGAGGG - Intergenic
1100641486 12:96485721-96485743 CTCAAAAAAAAGAGAGAGGAGGG - Intergenic
1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG + Intergenic
1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG + Intergenic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1101816349 12:108149014-108149036 CTGACTAAACAGAAAGGAAAGGG - Intronic
1101816349 12:108149014-108149036 CTGACTAAACAGAAAGGAAAGGG - Intronic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1101951943 12:109183864-109183886 CTGAAGGAAGAAAAAGAGGAAGG - Intronic
1101953970 12:109197599-109197621 CTGAACAAACAGATAGTGGCAGG + Intronic
1101953970 12:109197599-109197621 CTGAACAAACAGATAGTGGCAGG + Intronic
1101982532 12:109420118-109420140 CTGAATATACAGAAACAGAGTGG - Intronic
1101982532 12:109420118-109420140 CTGAATATACAGAAACAGAGTGG - Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1103429122 12:120866486-120866508 CTGAATTAACTGAAATAGTAAGG + Intronic
1103429122 12:120866486-120866508 CTGAATTAACTGAAATAGTAAGG + Intronic
1105435594 13:20375440-20375462 TTGAATAAACTAAAAGAAGATGG + Intergenic
1105435594 13:20375440-20375462 TTGAATAAACTAAAAGAAGATGG + Intergenic
1106273391 13:28176973-28176995 CTGAAAAACCAGGAAGAAGAAGG + Intronic
1106273391 13:28176973-28176995 CTGAAAAACCAGGAAGAAGAAGG + Intronic
1107118679 13:36775170-36775192 CTGACCAAACAGATAGAAGACGG - Intergenic
1107118679 13:36775170-36775192 CTGACCAAACAGATAGAAGACGG - Intergenic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1107763149 13:43703297-43703319 CTGTAGAAACATAAAGAGTATGG + Intronic
1107933229 13:45323724-45323746 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1107933229 13:45323724-45323746 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1108389457 13:49934181-49934203 CTGAATAAAATGAAAGAAAAGGG - Intronic
1108389457 13:49934181-49934203 CTGAATAAAATGAAAGAAAAGGG - Intronic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1108826756 13:54421842-54421864 CTCAATAAACAAAATCAGGAAGG + Intergenic
1108826756 13:54421842-54421864 CTCAATAAACAAAATCAGGAAGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1109820642 13:67648081-67648103 TTGAAAAAAAAGAAAGGGGAAGG + Intergenic
1109820642 13:67648081-67648103 TTGAAAAAAAAGAAAGGGGAAGG + Intergenic
1109826938 13:67734076-67734098 CTAAATAAAAGGCAAGAGGAAGG - Intergenic
1109826938 13:67734076-67734098 CTAAATAAAAGGCAAGAGGAAGG - Intergenic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1109990267 13:70045864-70045886 TTGACAAAACAGATAGAGGAAGG - Intronic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1111010627 13:82309759-82309781 CTGAATCAACAGAAATACAAAGG - Intergenic
1111010627 13:82309759-82309781 CTGAATCAACAGAAATACAAAGG - Intergenic
1111373797 13:87352485-87352507 CAGAATAAACAGCCAAAGGATGG - Intergenic
1111373797 13:87352485-87352507 CAGAATAAACAGCCAAAGGATGG - Intergenic
1111767712 13:92554279-92554301 CTGAATGAAAAGACAGAGGGTGG - Intronic
1111767712 13:92554279-92554301 CTGAATGAAAAGACAGAGGGTGG - Intronic
1112215770 13:97430482-97430504 CTGATTAAACATAAAGGGGAAGG - Intergenic
1112215770 13:97430482-97430504 CTGATTAAACATAAAGGGGAAGG - Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113176039 13:107565023-107565045 CTGTATAAACACAAAGAAGTAGG + Intronic
1113176039 13:107565023-107565045 CTGTATAAACACAAAGAAGTAGG + Intronic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1113360418 13:109625968-109625990 TTCACTAGACAGAAAGAGGAGGG + Intergenic
1113360418 13:109625968-109625990 TTCACTAGACAGAAAGAGGAGGG + Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1114737886 14:25061751-25061773 ATAAAGAAAAAGAAAGAGGAAGG + Intergenic
1114834524 14:26187906-26187928 CTTAATTAACAGAAAAAGAAAGG + Intergenic
1114834524 14:26187906-26187928 CTTAATTAACAGAAAAAGAAAGG + Intergenic
1114844743 14:26307863-26307885 CTGAAAGAACAAAAAGAAGAAGG - Intergenic
1114844743 14:26307863-26307885 CTGAAAGAACAAAAAGAAGAAGG - Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115078647 14:29422809-29422831 CTGAATAAAAAAAGAAAGGAAGG - Intergenic
1115078647 14:29422809-29422831 CTGAATAAAAAAAGAAAGGAAGG - Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1115854936 14:37621227-37621249 CTGAAAAAAAAGAAAAATGAAGG - Intronic
1115854936 14:37621227-37621249 CTGAAAAAAAAGAAAAATGAAGG - Intronic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1116041316 14:39689554-39689576 TTAAATAAATAGAAAGAGAAAGG + Intergenic
1116041316 14:39689554-39689576 TTAAATAAATAGAAAGAGAAAGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1118232034 14:63961373-63961395 CTGAGTAAACAGAGATTGGATGG + Intronic
1118232034 14:63961373-63961395 CTGAGTAAACAGAGATTGGATGG + Intronic
1118294794 14:64559092-64559114 ATAAATAAACAGAGAAAGGAAGG + Intronic
1118294794 14:64559092-64559114 ATAAATAAACAGAGAAAGGAAGG + Intronic
1118395130 14:65329754-65329776 CTGAATACTCAAAGAGAGGAAGG + Intergenic
1118395130 14:65329754-65329776 CTGAATACTCAAAGAGAGGAAGG + Intergenic
1118502319 14:66373362-66373384 ATGAATACATAGAAAGAGGCAGG - Intergenic
1118502319 14:66373362-66373384 ATGAATACATAGAAAGAGGCAGG - Intergenic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1119360492 14:74045036-74045058 CTGAGGAAACAGAAACAGAAAGG - Intronic
1119476637 14:74934342-74934364 CTATATACACACAAAGAGGAAGG + Intergenic
1119476637 14:74934342-74934364 CTATATACACACAAAGAGGAAGG + Intergenic
1119484362 14:74978321-74978343 CTGAAAAAAAGGAAAAAGGAGGG + Intergenic
1119484362 14:74978321-74978343 CTGAAAAAAAGGAAAAAGGAGGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1121233034 14:92372310-92372332 CTGAATAAATGGGAACAGGAGGG + Intronic
1121233034 14:92372310-92372332 CTGAATAAATGGGAACAGGAGGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1121861669 14:97324433-97324455 CTGAATCAGCAGAAACAGGAAGG - Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122998386 14:105277753-105277775 CTCAAAAAAGAGAAAGAAGATGG - Intronic
1122998386 14:105277753-105277775 CTCAAAAAAGAGAAAGAAGATGG - Intronic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123414699 15:20086809-20086831 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1123524041 15:21093923-21093945 CTTAAAAAAAAGAAAGAGGCTGG + Intergenic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124939018 15:34200559-34200581 CTGAATTAAGAGAAAGTGGTGGG - Intronic
1124939018 15:34200559-34200581 CTGAATTAAGAGAAAGTGGTGGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125987839 15:44072827-44072849 CTGAATAAAATGAAAGATCAAGG + Intronic
1125987839 15:44072827-44072849 CTGAATAAAATGAAAGATCAAGG + Intronic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1127407968 15:58672825-58672847 CTGAAAAAAAAAGAAGAGGAAGG + Intronic
1127407968 15:58672825-58672847 CTGAAAAAAAAAGAAGAGGAAGG + Intronic
1127701075 15:61501805-61501827 CTGAGTAAAAACAAAGAGAAAGG + Intergenic
1127701075 15:61501805-61501827 CTGAGTAAAAACAAAGAGAAAGG + Intergenic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1127965700 15:63921354-63921376 CTGAGGAAACAGGGAGAGGATGG - Intronic
1127999980 15:64181910-64181932 CTGAATAGTCATAAAGAGGAGGG + Intronic
1127999980 15:64181910-64181932 CTGAATAGTCATAAAGAGGAGGG + Intronic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128050133 15:64656795-64656817 CTGGATCTAAAGAAAGAGGAAGG - Intronic
1128151532 15:65366368-65366390 CTAAAGAAAAAGAAAGAGGCAGG + Intronic
1128151532 15:65366368-65366390 CTAAAGAAAAAGAAAGAGGCAGG + Intronic
1128765188 15:70247049-70247071 CTGAGTCAAAATAAAGAGGAAGG - Intergenic
1128765188 15:70247049-70247071 CTGAGTCAAAATAAAGAGGAAGG - Intergenic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1128780380 15:70355200-70355222 CTGAAAAAGCAGAAAGAGCTGGG - Intergenic
1129009845 15:72405606-72405628 CAGAATAAAAAAAAAGTGGAGGG + Intronic
1129009845 15:72405606-72405628 CAGAATAAAAAAAAAGTGGAGGG + Intronic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1130612415 15:85373435-85373457 CTGAATAAACTGGAAAAGGTTGG + Intergenic
1130612415 15:85373435-85373457 CTGAATAAACTGGAAAAGGTTGG + Intergenic
1131156187 15:90077179-90077201 CTTAATAAACAAAATGGGGACGG + Intronic
1131156187 15:90077179-90077201 CTTAATAAACAAAATGGGGACGG + Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1131826930 15:96329935-96329957 AGGAATAAACAGAAACAGAACGG + Intronic
1131826930 15:96329935-96329957 AGGAATAAACAGAAACAGAACGG + Intronic
1132020180 15:98354212-98354234 CCGAAGAAACTGAAAGAGAATGG + Intergenic
1132020180 15:98354212-98354234 CCGAAGAAACTGAAAGAGAATGG + Intergenic
1133863674 16:9620939-9620961 CTGAAAAAAAAGAAAGAGAGAGG + Intergenic
1133863674 16:9620939-9620961 CTGAAAAAAAAGAAAGAGAGAGG + Intergenic
1134145104 16:11754491-11754513 CTGAATCAACAGAGAGACGGAGG + Intronic
1134145104 16:11754491-11754513 CTGAATCAACAGAGAGACGGAGG + Intronic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1134688351 16:16174356-16174378 ATTAATAGACAGAAAAAGGAAGG - Intronic
1134688351 16:16174356-16174378 ATTAATAGACAGAAAAAGGAAGG - Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135075234 16:19387473-19387495 CTCAAGAGAGAGAAAGAGGAAGG + Intergenic
1135534035 16:23278994-23279016 CTTAATAAAAAAAAAGGGGAGGG + Intronic
1135534035 16:23278994-23279016 CTTAATAAAAAAAAAGGGGAGGG + Intronic
1135701716 16:24638414-24638436 CTCAAAAAACAGAAACAGGATGG + Intergenic
1135701716 16:24638414-24638436 CTCAAAAAACAGAAACAGGATGG + Intergenic
1137652445 16:50132144-50132166 CTGAATCAACAAAAAAAGAAGGG - Intergenic
1137652445 16:50132144-50132166 CTGAATCAACAAAAAAAGAAGGG - Intergenic
1138154065 16:54686171-54686193 CTCAATAAAAAGAAAAAGGAAGG - Intergenic
1138154065 16:54686171-54686193 CTCAATAAAAAGAAAAAGGAAGG - Intergenic
1138538137 16:57670774-57670796 CTGAATAAAGAGTAACAGCAGGG - Intronic
1138538137 16:57670774-57670796 CTGAATAAAGAGTAACAGCAGGG - Intronic
1138624386 16:58237452-58237474 CTGAAAGAAGAAAAAGAGGAGGG - Intronic
1138624386 16:58237452-58237474 CTGAAAGAAGAAAAAGAGGAGGG - Intronic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139254468 16:65527876-65527898 CTGAAGAAAAATGAAGAGGAAGG + Intergenic
1139254468 16:65527876-65527898 CTGAAGAAAAATGAAGAGGAAGG + Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1139411745 16:66767633-66767655 GTGAATAAACAGAAAGATTCTGG + Intronic
1140139720 16:72244121-72244143 CAGAAGAAATAAAAAGAGGAAGG + Intergenic
1140139720 16:72244121-72244143 CAGAAGAAATAAAAAGAGGAAGG + Intergenic
1140232188 16:73126455-73126477 CTGAAGAAACAGAAACAGATGGG + Intergenic
1140232188 16:73126455-73126477 CTGAAGAAACAGAAACAGATGGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1140932409 16:79640045-79640067 CTGAACACACAGAAAGTGGTAGG + Intergenic
1140932409 16:79640045-79640067 CTGAACACACAGAAAGTGGTAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141584279 16:85022983-85023005 CTGACTAGGCAGACAGAGGAAGG + Intergenic
1141584279 16:85022983-85023005 CTGACTAGGCAGACAGAGGAAGG + Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1142779213 17:2167872-2167894 CTGAAAAAAAAGAAAGAAAAAGG - Intronic
1142779213 17:2167872-2167894 CTGAAAAAAAAGAAAGAAAAAGG - Intronic
1142805200 17:2367805-2367827 CTGACTTAACAGAAACAGGATGG + Intronic
1142805200 17:2367805-2367827 CTGACTTAACAGAAACAGGATGG + Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1143814742 17:9503522-9503544 ATGAATAAAAAGGAAGAGGGAGG - Intronic
1143814742 17:9503522-9503544 ATGAATAAAAAGGAAGAGGGAGG - Intronic
1144255404 17:13462654-13462676 CTGATTATAAACAAAGAGGAGGG + Intergenic
1144255404 17:13462654-13462676 CTGATTATAAACAAAGAGGAGGG + Intergenic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148011961 17:44489666-44489688 CTAGAAAAACAAAAAGAGGAAGG + Intronic
1148056981 17:44805016-44805038 CTCACTAAACAGTAAAAGGAGGG - Exonic
1148056981 17:44805016-44805038 CTCACTAAACAGTAAAAGGAGGG - Exonic
1148416932 17:47513996-47514018 ATGAATAAACTGAAACAGCAAGG + Intergenic
1148416932 17:47513996-47514018 ATGAATAAACTGAAACAGCAAGG + Intergenic
1149293760 17:55242011-55242033 GTGAAGAAACAGGAAGAAGATGG - Intergenic
1149293760 17:55242011-55242033 GTGAAGAAACAGGAAGAAGATGG - Intergenic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1150150485 17:62804928-62804950 CTGAATAAACAGGAGGAGCGAGG - Intronic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150204531 17:63392357-63392379 TTGAAAATCCAGAAAGAGGAGGG - Intronic
1150641073 17:66949896-66949918 ATAAAAACACAGAAAGAGGAGGG - Intergenic
1150641073 17:66949896-66949918 ATAAAAACACAGAAAGAGGAGGG - Intergenic
1151304181 17:73252433-73252455 ATGAATACACATTAAGAGGATGG + Intronic
1151304181 17:73252433-73252455 ATGAATACACATTAAGAGGATGG + Intronic
1151968783 17:77446359-77446381 CTCAAAAAAAAAAAAGAGGAAGG - Intronic
1151968783 17:77446359-77446381 CTCAAAAAAAAAAAAGAGGAAGG - Intronic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1203175990 17_KI270729v1_random:13448-13470 CTGAATAAACTGGAAGGGAATGG - Intergenic
1203175990 17_KI270729v1_random:13448-13470 CTGAATAAACTGGAAGGGAATGG - Intergenic
1153054754 18:934895-934917 CTGAATGGACAGGAAGAGTAGGG - Intergenic
1153054754 18:934895-934917 CTGAATGGACAGGAAGAGTAGGG - Intergenic
1153062386 18:1007565-1007587 CTGAAAGAACTGAAAGACGAAGG - Intergenic
1153062386 18:1007565-1007587 CTGAAAGAACTGAAAGACGAAGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1154292200 18:13118476-13118498 ACGAATAAAAAGAAAGAGTAAGG - Intronic
1154292200 18:13118476-13118498 ACGAATAAAAAGAAAGAGTAAGG - Intronic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156627144 18:38922837-38922859 CCCAATAAACAGAAAGAGCATGG - Intergenic
1156627144 18:38922837-38922859 CCCAATAAACAGAAAGAGCATGG - Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1159125128 18:64214892-64214914 CTGAATTGACAGGTAGAGGAAGG + Intergenic
1159125128 18:64214892-64214914 CTGAATTGACAGGTAGAGGAAGG + Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1162611993 19:11763115-11763137 TTGGTTAAACAGAAAGAGAAGGG + Intergenic
1162611993 19:11763115-11763137 TTGGTTAAACAGAAAGAGAAGGG + Intergenic
1163058410 19:14740102-14740124 CTAAAAAAAAAAAAAGAGGATGG + Intronic
1163058410 19:14740102-14740124 CTAAAAAAAAAAAAAGAGGATGG + Intronic
1163502217 19:17683071-17683093 ATAAATAAATAGAAAGAAGAAGG + Intronic
1163502217 19:17683071-17683093 ATAAATAAATAGAAAGAAGAAGG + Intronic
1164220575 19:23189570-23189592 CTTGATAAAAATAAAGAGGATGG + Intergenic
1164220575 19:23189570-23189592 CTTGATAAAAATAAAGAGGATGG + Intergenic
1165163731 19:33834962-33834984 CTCCCTAAACAGAAAGAAGATGG + Intergenic
1165163731 19:33834962-33834984 CTCCCTAAACAGAAAGAAGATGG + Intergenic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
925714544 2:6772382-6772404 CTGAACACAGAGACAGAGGAAGG - Intergenic
925714544 2:6772382-6772404 CTGAACACAGAGACAGAGGAAGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926106084 2:10152363-10152385 CTGAATAAAATGAAAAAGAAGGG - Intronic
926106084 2:10152363-10152385 CTGAATAAAATGAAAAAGAAGGG - Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926428010 2:12757351-12757373 CTGAATAAATACACAAAGGAAGG - Intergenic
926428010 2:12757351-12757373 CTGAATAAATACACAAAGGAAGG - Intergenic
926536617 2:14121135-14121157 CTGAAAAAAAAGAAAGACAAAGG - Intergenic
926536617 2:14121135-14121157 CTGAAAAAAAAGAAAGACAAAGG - Intergenic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
926999083 2:18773473-18773495 CTGAATAAAGAGAAAAGTGAGGG - Intergenic
926999083 2:18773473-18773495 CTGAATAAAGAGAAAAGTGAGGG - Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927622107 2:24672227-24672249 CTGAAAAAAGGGACAGAGGAGGG + Intronic
927622107 2:24672227-24672249 CTGAAAAAAGGGACAGAGGAGGG + Intronic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928071196 2:28219177-28219199 CTGAACAACCTGAAAGAGTAAGG - Intronic
928071196 2:28219177-28219199 CTGAACAACCTGAAAGAGTAAGG - Intronic
928711134 2:34006893-34006915 ATAAATAAACAAACAGAGGATGG - Intergenic
928711134 2:34006893-34006915 ATAAATAAACAAACAGAGGATGG - Intergenic
929663573 2:43815095-43815117 GTGATTAAACAGAAAGTTGAAGG + Intronic
929663573 2:43815095-43815117 GTGATTAAACAGAAAGTTGAAGG + Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932193271 2:69759341-69759363 TGGAATAAACAGAAAGTAGATGG + Intronic
932193271 2:69759341-69759363 TGGAATAAACAGAAAGTAGATGG + Intronic
932209091 2:69913067-69913089 CTGAAGAAAAAGAAAGACAAAGG - Intronic
932209091 2:69913067-69913089 CTGAAGAAAAAGAAAGACAAAGG - Intronic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
932827378 2:74954309-74954331 CAGAAGAAACAGGAAGACGAAGG - Intergenic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936641851 2:114321770-114321792 CTGAATAAATAGCCAGAAGATGG + Intergenic
936641851 2:114321770-114321792 CTGAATAAATAGCCAGAAGATGG + Intergenic
936652420 2:114443528-114443550 CCGAATAAAAACAAAGAGAATGG - Intronic
936652420 2:114443528-114443550 CCGAATAAAAACAAAGAGAATGG - Intronic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
938600903 2:132838066-132838088 GTGAATAAGTTGAAAGAGGAGGG - Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
939524227 2:143272283-143272305 CAGAAAAAGCAGAAAGAGTATGG - Intronic
940353254 2:152712493-152712515 CTGAATAAATAGAATTAGGGAGG + Intronic
940353254 2:152712493-152712515 CTGAATAAATAGAATTAGGGAGG + Intronic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940610600 2:155986302-155986324 CTTATTAAACAGAAAGACAAGGG + Intergenic
940610600 2:155986302-155986324 CTTATTAAACAGAAAGACAAGGG + Intergenic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941244266 2:163077819-163077841 ATGAATAAACATGAATAGGAGGG - Intergenic
941244266 2:163077819-163077841 ATGAATAAACATGAATAGGAGGG - Intergenic
941431393 2:165418288-165418310 TTGAATATATAGAAAGATGAGGG + Intergenic
941431393 2:165418288-165418310 TTGAATATATAGAAAGATGAGGG + Intergenic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942501307 2:176593680-176593702 ATGATTAAATACAAAGAGGATGG + Intergenic
942501307 2:176593680-176593702 ATGATTAAATACAAAGAGGATGG + Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943207371 2:184918207-184918229 CTGAATCAACAGGCAAAGGAGGG - Intronic
943207371 2:184918207-184918229 CTGAATCAACAGGCAAAGGAGGG - Intronic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943575884 2:189630625-189630647 CAGAATGAACAGAAAAAGGTTGG + Intergenic
943575884 2:189630625-189630647 CAGAATGAACAGAAAAAGGTTGG + Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG + Intergenic
944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG + Intergenic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944294116 2:198042852-198042874 TTGCATAAACAGACAGAGAAAGG + Intronic
944742398 2:202625184-202625206 GTCAATAAACCAAAAGAGGAAGG + Intergenic
944742398 2:202625184-202625206 GTCAATAAACCAAAAGAGGAAGG + Intergenic
944742401 2:202625207-202625229 ATCAATAAACCAAAAGAGGAAGG + Intergenic
944742401 2:202625207-202625229 ATCAATAAACCAAAAGAGGAAGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
947137061 2:226985860-226985882 CTGGATAAACTGGAAGAGGTAGG - Intronic
947137061 2:226985860-226985882 CTGGATAAACTGGAAGAGGTAGG - Intronic
947211822 2:227715621-227715643 CAGAATAAACAGAATTTGGAAGG - Intronic
947211822 2:227715621-227715643 CAGAATAAACAGAATTTGGAAGG - Intronic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
947952002 2:234156214-234156236 GGGAAGAAAAAGAAAGAGGAGGG - Intergenic
947952002 2:234156214-234156236 GGGAAGAAAAAGAAAGAGGAGGG - Intergenic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1168989253 20:2080167-2080189 CTGAAAAAAGAAAAAGGGGAAGG - Intergenic
1168989253 20:2080167-2080189 CTGAAAAAAGAAAAAGGGGAAGG - Intergenic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169787327 20:9373441-9373463 CTCATTAAATAGAAAGAGAATGG + Intronic
1169787327 20:9373441-9373463 CTCATTAAATAGAAAGAGAATGG + Intronic
1170848932 20:19986296-19986318 CTTAATAAACATAAAGAGTAGGG - Intronic
1170848932 20:19986296-19986318 CTTAATAAACATAAAGAGTAGGG - Intronic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1171515858 20:25734459-25734481 CTAAATAAACAGAGTGACGAGGG + Intergenic
1171515858 20:25734459-25734481 CTAAATAAACAGAGTGACGAGGG + Intergenic
1172076056 20:32298512-32298534 CTTAAAAAACAAAAACAGGAAGG - Intronic
1172076056 20:32298512-32298534 CTTAAAAAACAAAAACAGGAAGG - Intronic
1172393346 20:34581642-34581664 CTGGATAAACATGAAGAAGATGG + Exonic
1172393346 20:34581642-34581664 CTGGATAAACATGAAGAAGATGG + Exonic
1173194440 20:40902733-40902755 CAGAATTAAAAGAAACAGGAGGG + Intergenic
1173194440 20:40902733-40902755 CAGAATTAAAAGAAACAGGAGGG + Intergenic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1173990981 20:47303271-47303293 CTGAAAAAAAAGAAAAAGAAGGG - Intronic
1173990981 20:47303271-47303293 CTGAAAAAAAAGAAAAAGAAGGG - Intronic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1174301553 20:49585906-49585928 CAGAATCCAGAGAAAGAGGAAGG + Intergenic
1174576394 20:51540896-51540918 CTTAATGAACAGAAAGACCACGG + Intronic
1174576394 20:51540896-51540918 CTTAATGAACAGAAAGACCACGG + Intronic
1174596864 20:51691042-51691064 CTGAGTAAACAGAGAAACGAGGG - Intronic
1174596864 20:51691042-51691064 CTGAGTAAACAGAGAAACGAGGG - Intronic
1174753948 20:53139929-53139951 ATGAGTGAACATAAAGAGGATGG - Intronic
1174753948 20:53139929-53139951 ATGAGTGAACATAAAGAGGATGG - Intronic
1175544177 20:59767475-59767497 GTGAATAAATAGATAGATGATGG - Intronic
1175544177 20:59767475-59767497 GTGAATAAATAGATAGATGATGG - Intronic
1176041513 20:63068407-63068429 GTGAATAAACAGACACAGGTGGG - Intergenic
1176041513 20:63068407-63068429 GTGAATAAACAGACACAGGTGGG - Intergenic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1178597081 21:33963863-33963885 CAGCATAAAATGAAAGAGGAGGG - Intergenic
1178597081 21:33963863-33963885 CAGCATAAAATGAAAGAGGAGGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1182567489 22:31211146-31211168 CCAAATGACCAGAAAGAGGATGG - Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183013464 22:34966864-34966886 ATGAGTAAACAAAAAGGGGACGG - Intergenic
1183013464 22:34966864-34966886 ATGAGTAAACAAAAAGGGGACGG - Intergenic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1183889600 22:40915698-40915720 CAGAATAGCCAGAAAGATGAAGG + Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
951252039 3:20405082-20405104 GTGAATAAACAGATATAGAATGG - Intergenic
951264008 3:20546577-20546599 TTCAATAAACAGTAAGAAGATGG - Intergenic
951264008 3:20546577-20546599 TTCAATAAACAGTAAGAAGATGG - Intergenic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952977911 3:38711674-38711696 CTGAATGAACAGGTAGATGAAGG + Intronic
952977911 3:38711674-38711696 CTGAATGAACAGGTAGATGAAGG + Intronic
953029795 3:39171435-39171457 CTCAATAAAAAGAAAGAAAATGG + Intergenic
953029795 3:39171435-39171457 CTCAATAAAAAGAAAGAAAATGG + Intergenic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954999867 3:54917729-54917751 ATAAACAAACACAAAGAGGATGG - Intronic
954999867 3:54917729-54917751 ATAAACAAACACAAAGAGGATGG - Intronic
955044300 3:55345273-55345295 CTGAGTATACTGAAAGAGAAAGG + Intergenic
955044300 3:55345273-55345295 CTGAGTATACTGAAAGAGAAAGG + Intergenic
955205526 3:56892478-56892500 GTGAATAAACATATAAAGGAGGG - Intronic
955205526 3:56892478-56892500 GTGAATAAACATATAAAGGAGGG - Intronic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956282537 3:67572949-67572971 ATGAATAAACAAGAAAAGGAAGG + Intronic
956282537 3:67572949-67572971 ATGAATAAACAAGAAAAGGAAGG + Intronic
956585906 3:70864398-70864420 CTGAATAAATTGAAAGTGGCTGG + Intergenic
956585906 3:70864398-70864420 CTGAATAAATTGAAAGTGGCTGG + Intergenic
957179671 3:76860222-76860244 ATGAATAAACAGAAAGCCGTCGG - Intronic
957179671 3:76860222-76860244 ATGAATAAACAGAAAGCCGTCGG - Intronic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957320659 3:78625960-78625982 CTGAATGAAGAGGAAGAGGCTGG + Intronic
957480537 3:80787792-80787814 CTGAATCAACAGAAAAAGAAGGG + Intergenic
957480537 3:80787792-80787814 CTGAATCAACAGAAAAAGAAGGG + Intergenic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958937687 3:100274896-100274918 ATGAATAAACAAAAAGGGGGGGG - Intronic
958937687 3:100274896-100274918 ATGAATAAACAAAAAGGGGGGGG - Intronic
959276362 3:104281938-104281960 CTGAAAAAAAAGAAAAAGAAGGG - Intergenic
959276362 3:104281938-104281960 CTGAAAAAAAAGAAAAAGAAGGG - Intergenic
959313953 3:104778218-104778240 CCAAATAAAGAGAAAGAGTATGG - Intergenic
959313953 3:104778218-104778240 CCAAATAAAGAGAAAGAGTATGG - Intergenic
959717301 3:109446858-109446880 CTCAAAAAAAAGAAAGAGAAAGG - Intergenic
959717301 3:109446858-109446880 CTCAAAAAAAAGAAAGAGAAAGG - Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
959999452 3:112715384-112715406 TTGAATAAACAGACTGAGTAAGG + Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960908726 3:122627255-122627277 GTAAATAAACAGGAAGAGAATGG + Intronic
960908726 3:122627255-122627277 GTAAATAAACAGGAAGAGAATGG + Intronic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
962085142 3:132183272-132183294 CTGAAAGAACAGAAAGAAAAAGG + Intronic
962085142 3:132183272-132183294 CTGAAAGAACAGAAAGAAAAAGG + Intronic
962593183 3:136912646-136912668 CTTAAAAAAAAAAAAGAGGAGGG - Intronic
962593183 3:136912646-136912668 CTTAAAAAAAAAAAAGAGGAGGG - Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
965019086 3:163203095-163203117 CTGAATAAAGTGAAAGAGACTGG + Intergenic
965019086 3:163203095-163203117 CTGAATAAAGTGAAAGAGACTGG + Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966268696 3:178079152-178079174 CTGAATGAACAGGATTAGGATGG + Intergenic
966268696 3:178079152-178079174 CTGAATGAACAGGATTAGGATGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966661610 3:182420734-182420756 CTGAATCAACAGGAAAAGAAGGG + Intergenic
966661610 3:182420734-182420756 CTGAATCAACAGGAAAAGAAGGG + Intergenic
967385859 3:188910228-188910250 CTGATCAAACAGAAAGAAAATGG + Intergenic
967385859 3:188910228-188910250 CTGATCAAACAGAAAGAAAATGG + Intergenic
967401585 3:189068773-189068795 CTCAAAAAAGAGAAAAAGGAAGG + Intronic
967401585 3:189068773-189068795 CTCAAAAAAGAGAAAAAGGAAGG + Intronic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
969986424 4:11216125-11216147 ATGGATAAACAGAAAGAGCTTGG - Intergenic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
970110111 4:12628307-12628329 CTGAATAAAAGAAAACAGGAGGG - Intergenic
970110111 4:12628307-12628329 CTGAATAAAAGAAAACAGGAGGG - Intergenic
970970576 4:21978921-21978943 CTTAAAAATCTGAAAGAGGAAGG - Intergenic
970970576 4:21978921-21978943 CTTAAAAATCTGAAAGAGGAAGG - Intergenic
971156461 4:24088359-24088381 CTAAAAAAAAAGAAAGAAGAAGG + Intergenic
971156461 4:24088359-24088381 CTAAAAAAAAAGAAAGAAGAAGG + Intergenic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
972322718 4:37987285-37987307 CTGAAAAAAAAAAAAGTGGAAGG - Intronic
972322718 4:37987285-37987307 CTGAAAAAAAAAAAAGTGGAAGG - Intronic
973824821 4:54694288-54694310 CTGAAGAAAAAGCAAGAGGTGGG - Intronic
973824821 4:54694288-54694310 CTGAAGAAAAAGCAAGAGGTGGG - Intronic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
975157023 4:71083477-71083499 CTTAATAATCAGAATCAGGAAGG - Intergenic
975157023 4:71083477-71083499 CTTAATAATCAGAATCAGGAAGG - Intergenic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
975363720 4:73503319-73503341 CTGATTGAACAGCAAGAGAAGGG - Intronic
975363720 4:73503319-73503341 CTGATTGAACAGCAAGAGAAGGG - Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976188403 4:82466046-82466068 AGAAATAAATAGAAAGAGGATGG - Intergenic
976188403 4:82466046-82466068 AGAAATAAATAGAAAGAGGATGG - Intergenic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977031057 4:91883513-91883535 ATGAATAAAAAGAAAGGAGACGG - Intergenic
977031057 4:91883513-91883535 ATGAATAAAAAGAAAGGAGACGG - Intergenic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977232344 4:94466699-94466721 CTGAAAAATCAGGAAGAGGCTGG - Intronic
977390138 4:96398531-96398553 CTTAATACACTTAAAGAGGAAGG + Intergenic
977390138 4:96398531-96398553 CTTAATACACTTAAAGAGGAAGG + Intergenic
978181985 4:105809429-105809451 CTGAATAAAGTGAGAGAGTAAGG - Intronic
978181985 4:105809429-105809451 CTGAATAAAGTGAGAGAGTAAGG - Intronic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978247288 4:106589247-106589269 ATGAACAGACAGAAAGAGGATGG - Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
980047378 4:128004133-128004155 CTAAAAAAACAAAAAGAGGCAGG - Intronic
980047378 4:128004133-128004155 CTAAAAAAACAAAAAGAGGCAGG - Intronic
980441175 4:132846885-132846907 CTGAATAAAAAGGAAGGTGAGGG + Intergenic
980441175 4:132846885-132846907 CTGAATAAAAAGGAAGGTGAGGG + Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980728349 4:136795047-136795069 CTGAATAATCAGATATAGAAGGG + Intergenic
980728349 4:136795047-136795069 CTGAATAATCAGATATAGAAGGG + Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981262629 4:142739958-142739980 CTGATTTAGCCGAAAGAGGATGG + Intronic
981262629 4:142739958-142739980 CTGATTTAGCCGAAAGAGGATGG + Intronic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
981843228 4:149136455-149136477 CTGTATAAACATAAAAAAGAAGG - Intergenic
981843228 4:149136455-149136477 CTGTATAAACATAAAAAAGAAGG - Intergenic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
981952187 4:150422894-150422916 CTGAACCAAGAGAAAGGGGATGG + Intronic
982463930 4:155706515-155706537 CTGAAAAAAAAAAAAGAGGAGGG - Intronic
982463930 4:155706515-155706537 CTGAAAAAAAAAAAAGAGGAGGG - Intronic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983606030 4:169585186-169585208 CTGAAGAAAAAGAAAGACCATGG + Intronic
983606030 4:169585186-169585208 CTGAAGAAAAAGAAAGACCATGG + Intronic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
986220626 5:5765758-5765780 CTGCATTATCAGGAAGAGGAGGG - Intergenic
986220626 5:5765758-5765780 CTGCATTATCAGGAAGAGGAGGG - Intergenic
986344279 5:6819968-6819990 CTGAATAAATGCAAAAAGGAAGG - Intergenic
986344279 5:6819968-6819990 CTGAATAAATGCAAAAAGGAAGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987399958 5:17464450-17464472 CTAAAAATACAGAAATAGGAGGG - Intergenic
987399958 5:17464450-17464472 CTAAAAATACAGAAATAGGAGGG - Intergenic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
987685405 5:21193147-21193169 GTGTATAGACAGAAAGAGGTTGG - Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989165601 5:38430954-38430976 CTGAACAAAAAGGAAGAGGAGGG - Intronic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
989344448 5:40413521-40413543 CTCAAGAAAGAGAAATAGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
990378233 5:55194731-55194753 CTGAAAGGACAGAAAGAGGCTGG - Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990439779 5:55832881-55832903 TTGAAGAAAGAGAAAGAGAATGG + Intergenic
990983316 5:61620478-61620500 CTGTATAAATAAAAAGAGTAAGG + Intergenic
990983316 5:61620478-61620500 CTGTATAAATAAAAAGAGTAAGG + Intergenic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992484845 5:77184681-77184703 CTTAAAAAATAGAAAGAGGCTGG + Intergenic
992484845 5:77184681-77184703 CTTAAAAAATAGAAAGAGGCTGG + Intergenic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992604933 5:78446170-78446192 CTGTACATACAGAAAGAGGAAGG + Intronic
992666727 5:79017614-79017636 CTGAATAAAATGAAAGTGTATGG - Intronic
992666727 5:79017614-79017636 CTGAATAAAATGAAAGTGTATGG - Intronic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995483441 5:112615175-112615197 CTGAATCAACAGGAAAAGAAGGG - Intergenic
995483441 5:112615175-112615197 CTGAATCAACAGGAAAAGAAGGG - Intergenic
995902754 5:117089593-117089615 ATGAATAAAAGGAAAGAGAATGG + Intergenic
995902754 5:117089593-117089615 ATGAATAAAAGGAAAGAGAATGG + Intergenic
996318478 5:122188003-122188025 TTTAATTAAAAGAAAGAGGAAGG + Intergenic
996318478 5:122188003-122188025 TTTAATTAAAAGAAAGAGGAAGG + Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
996813746 5:127550309-127550331 ATGAATAAAAAGAAACAGGGAGG - Intronic
996813746 5:127550309-127550331 ATGAATAAAAAGAAACAGGGAGG - Intronic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
997464484 5:134078250-134078272 CTGCACACACAGACAGAGGAGGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998444691 5:142189482-142189504 CTGAATGAAGTGACAGAGGAAGG - Intergenic
998444691 5:142189482-142189504 CTGAATGAAGTGACAGAGGAAGG - Intergenic
998538559 5:142957148-142957170 TTGAATCAAAAGAATGAGGATGG + Intronic
998538559 5:142957148-142957170 TTGAATCAAAAGAATGAGGATGG + Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998675590 5:144404156-144404178 CTGGAAAAAGAGTAAGAGGATGG + Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000574671 5:162963337-162963359 CGGAATAAAAAGAAATAGAATGG + Intergenic
1000574671 5:162963337-162963359 CGGAATAAAAAGAAATAGAATGG + Intergenic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1001370800 5:171198829-171198851 CTGAAGAAACAGGCAGAGAAAGG - Intronic
1002432498 5:179211641-179211663 ATCAATAAACAGGGAGAGGATGG + Intronic
1002432498 5:179211641-179211663 ATCAATAAACAGGGAGAGGATGG + Intronic
1002795525 6:468198-468220 CTGAATAAACAGAAATGTGATGG + Intergenic
1002795525 6:468198-468220 CTGAATAAACAGAAATGTGATGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1003734334 6:8860939-8860961 TTGAATAAACTGAGAGATGATGG + Intergenic
1003734334 6:8860939-8860961 TTGAATAAACTGAGAGATGATGG + Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1003935118 6:10968243-10968265 CTGAAGAAACTGCTAGAGGAGGG + Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004343421 6:14827274-14827296 TGGAATAAAGACAAAGAGGAAGG + Intergenic
1004343421 6:14827274-14827296 TGGAATAAAGACAAAGAGGAAGG + Intergenic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004875764 6:19951922-19951944 CTGAATAAAAAGAAAAAAGTTGG - Intergenic
1004875764 6:19951922-19951944 CTGAATAAAAAGAAAAAAGTTGG - Intergenic
1005373264 6:25156599-25156621 TTGAATGACCAGATAGAGGAAGG - Intergenic
1005373264 6:25156599-25156621 TTGAATGACCAGATAGAGGAAGG - Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005419062 6:25630460-25630482 GTGAAGAAACAGAAAGAGAATGG + Intergenic
1005701647 6:28407160-28407182 ATGAATAAAGGAAAAGAGGAAGG + Intergenic
1005701647 6:28407160-28407182 ATGAATAAAGGAAAAGAGGAAGG + Intergenic
1006040225 6:31246423-31246445 CTGAATCAACAGACAAAGGAAGG - Intergenic
1006040225 6:31246423-31246445 CTGAATCAACAGACAAAGGAAGG - Intergenic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007262359 6:40572651-40572673 CTAAATAAACAGAAAGGACAGGG - Intronic
1007262359 6:40572651-40572673 CTAAATAAACAGAAAGGACAGGG - Intronic
1007500561 6:42293748-42293770 CTGAATACACAGCAACAGGGTGG - Intronic
1007500561 6:42293748-42293770 CTGAATACACAGCAACAGGGTGG - Intronic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008387138 6:50904731-50904753 CTGAATGAACATCCAGAGGATGG - Intergenic
1008387138 6:50904731-50904753 CTGAATGAACATCCAGAGGATGG - Intergenic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010499136 6:76573294-76573316 TTGAATAATCACAAAGAGCAGGG + Intergenic
1010499136 6:76573294-76573316 TTGAATAATCACAAAGAGCAGGG + Intergenic
1010848213 6:80738465-80738487 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
1010848213 6:80738465-80738487 CTGAAAAAAAAAAAAAAGGAAGG - Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011310140 6:85972566-85972588 CTGGACAAAAAGAAAGGGGAGGG - Intergenic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1011463306 6:87628794-87628816 CAAAAGAAACAGAAAGAGGTGGG - Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1012471597 6:99578624-99578646 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1012471597 6:99578624-99578646 CAGAACAAAAAGACAGAGGAAGG - Intergenic
1012599700 6:101079880-101079902 CTGCATAAACAGTCAGATGAGGG - Intergenic
1012599700 6:101079880-101079902 CTGCATAAACAGTCAGATGAGGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1014707168 6:124761863-124761885 TGGAAAAAACAGAAATAGGAAGG + Intronic
1014707168 6:124761863-124761885 TGGAAAAAACAGAAATAGGAAGG + Intronic
1014786785 6:125628499-125628521 TTGAATAAACTGAAAGACTAGGG + Intergenic
1014786785 6:125628499-125628521 TTGAATAAACTGAAAGACTAGGG + Intergenic
1014830514 6:126097901-126097923 AAGAATAAACAAAAAGAGTATGG - Intergenic
1014830514 6:126097901-126097923 AAGAATAAACAAAAAGAGTATGG - Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1016280207 6:142408474-142408496 CTCAATAATCAGAAAGAGAAGGG + Intronic
1016501021 6:144720782-144720804 ATGAATAAATACACAGAGGAGGG - Intronic
1016501021 6:144720782-144720804 ATGAATAAATACACAGAGGAGGG - Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1018599035 6:165519011-165519033 TTGAATAAAAAGAAAGATGAGGG + Intronic
1019222091 6:170480952-170480974 CTGAATCAACAGACAAAGAAAGG + Intergenic
1019222091 6:170480952-170480974 CTGAATCAACAGACAAAGAAAGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1020121003 7:5503351-5503373 CTCAAAAAACAGAAACAGGCTGG - Intronic
1020121003 7:5503351-5503373 CTCAAAAAACAGAAACAGGCTGG - Intronic
1020589542 7:10117342-10117364 TTGAAAAAAAAGAAAGAAGAAGG - Intergenic
1020589542 7:10117342-10117364 TTGAAAAAAAAGAAAGAAGAAGG - Intergenic
1020917555 7:14215189-14215211 CAGAATAAACAGGAAGAATATGG + Intronic
1020917555 7:14215189-14215211 CAGAATAAACAGGAAGAATATGG + Intronic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1020951313 7:14681919-14681941 ATGATTTAACTGAAAGAGGAAGG + Intronic
1020951313 7:14681919-14681941 ATGATTTAACTGAAAGAGGAAGG + Intronic
1020960092 7:14791584-14791606 CTGATAAAACAGAAAAAGAAGGG - Intronic
1020960092 7:14791584-14791606 CTGATAAAACAGAAAAAGAAGGG - Intronic
1020975448 7:15000433-15000455 CTGACTCAACAGATAGAGGGTGG + Intergenic
1020975448 7:15000433-15000455 CTGACTCAACAGATAGAGGGTGG + Intergenic
1022176044 7:27872861-27872883 CTGCATAAAAAGATAGGGGATGG + Intronic
1022176044 7:27872861-27872883 CTGCATAAAAAGATAGGGGATGG + Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022588550 7:31639189-31639211 CTGAAAAATCCCAAAGAGGAGGG - Intronic
1022588550 7:31639189-31639211 CTGAAAAATCCCAAAGAGGAGGG - Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026990589 7:74583016-74583038 TTAAATAAAAAGAAAGAGGTAGG + Intronic
1026990589 7:74583016-74583038 TTAAATAAAAAGAAAGAGGTAGG + Intronic
1027520307 7:79198587-79198609 TTGAATAAAAAGTAAGAGGTAGG + Intronic
1027520307 7:79198587-79198609 TTGAATAAAAAGTAAGAGGTAGG + Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1027849177 7:83427231-83427253 TTGAAGAAAAAGAAAGAGAAAGG - Intronic
1028381786 7:90208336-90208358 CTGAAAAAAAAGAGAAAGGAAGG + Intronic
1028381786 7:90208336-90208358 CTGAAAAAAAAGAGAAAGGAAGG + Intronic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1029293978 7:99524803-99524825 ATGAATTCACAGGAAGAGGAAGG + Intronic
1029293978 7:99524803-99524825 ATGAATTCACAGGAAGAGGAAGG + Intronic
1029571843 7:101375079-101375101 ATAAATAAAAAAAAAGAGGAAGG + Intronic
1029571843 7:101375079-101375101 ATAAATAAAAAAAAAGAGGAAGG + Intronic
1030551372 7:110964778-110964800 AGGAAAAAATAGAAAGAGGAAGG - Intronic
1030551372 7:110964778-110964800 AGGAAAAAATAGAAAGAGGAAGG - Intronic
1030765898 7:113409261-113409283 TTGAATAAAAAGGTAGAGGAAGG + Intergenic
1030765898 7:113409261-113409283 TTGAATAAAAAGGTAGAGGAAGG + Intergenic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1030872952 7:114780240-114780262 CTGAATAAAAACATAAAGGAAGG + Intergenic
1030872952 7:114780240-114780262 CTGAATAAAAACATAAAGGAAGG + Intergenic
1031099379 7:117460637-117460659 CTAAATAAAAAGAAAGACAAAGG - Intergenic
1031099379 7:117460637-117460659 CTAAATAAAAAGAAAGACAAAGG - Intergenic
1031135294 7:117877447-117877469 CTGAATAAACAGAAATATTCAGG - Intergenic
1031135294 7:117877447-117877469 CTGAATAAACAGAAATATTCAGG - Intergenic
1031291974 7:119949467-119949489 GTGAAGAAACATAAAGAGGGTGG - Intergenic
1031291974 7:119949467-119949489 GTGAAGAAACATAAAGAGGGTGG - Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1032482040 7:132255026-132255048 CTGAATGGACAGAAATAGGGTGG - Intronic
1032482040 7:132255026-132255048 CTGAATGGACAGAAATAGGGTGG - Intronic
1032540581 7:132699712-132699734 CTCAAAAAAAAAAAAGAGGAAGG + Intronic
1032540581 7:132699712-132699734 CTCAAAAAAAAAAAAGAGGAAGG + Intronic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1034135638 7:148766127-148766149 CTCAAAAAACAGAAAGAAAAAGG - Intronic
1034135638 7:148766127-148766149 CTCAAAAAACAGAAAGAAAAAGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035482002 7:159194369-159194391 CCAAGTAAACAGAAAGAGGTCGG + Intergenic
1035482002 7:159194369-159194391 CCAAGTAAACAGAAAGAGGTCGG + Intergenic
1035547434 8:494255-494277 GTGAATAAACAGAAATGGGCTGG - Intronic
1035547434 8:494255-494277 GTGAATAAACAGAAATGGGCTGG - Intronic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1035976520 8:4318338-4318360 GTGCATAAAAAGAGAGAGGAGGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037219082 8:16495350-16495372 CTGAGTACACAGCAAGAAGACGG + Intronic
1037219082 8:16495350-16495372 CTGAGTACACAGCAAGAAGACGG + Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037510778 8:19579675-19579697 CTGAATAAACAGAAAGTTAAAGG + Intronic
1037510778 8:19579675-19579697 CTGAATAAACAGAAAGTTAAAGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038515917 8:28187638-28187660 TTGAATAAAATGAAAGAGAAAGG - Intronic
1038515917 8:28187638-28187660 TTGAATAAAATGAAAGAGAAAGG - Intronic
1038698680 8:29829201-29829223 GTGAATAAATAGAAAAGGGAAGG + Intergenic
1038698680 8:29829201-29829223 GTGAATAAATAGAAAAGGGAAGG + Intergenic
1039221427 8:35335285-35335307 CTAAATAACCAGAAATAGAATGG + Intronic
1039221427 8:35335285-35335307 CTAAATAACCAGAAATAGAATGG + Intronic
1039592199 8:38758174-38758196 CTGAATTAAAATAAAGAGTATGG - Intronic
1039592199 8:38758174-38758196 CTGAATTAAAATAAAGAGTATGG - Intronic
1039975803 8:42363878-42363900 CTGTATAAACACCAACAGGAAGG + Intronic
1039975803 8:42363878-42363900 CTGTATAAACACCAACAGGAAGG + Intronic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1040877091 8:52165336-52165358 CTGAATAGAGAGAGAGAGCATGG - Intronic
1040877091 8:52165336-52165358 CTGAATAGAGAGAGAGAGCATGG - Intronic
1041172738 8:55161501-55161523 CTGAAAAAACAGAAAAGGGCAGG + Exonic
1041172738 8:55161501-55161523 CTGAAAAAACAGAAAAGGGCAGG + Exonic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041473617 8:58238593-58238615 CTGAACAAAGAGAAAGAAAATGG + Intergenic
1041473617 8:58238593-58238615 CTGAACAAAGAGAAAGAAAATGG + Intergenic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042519324 8:69694427-69694449 GTCAATAAAGAGAAAGATGAAGG - Intronic
1042519324 8:69694427-69694449 GTCAATAAAGAGAAAGATGAAGG - Intronic
1042659106 8:71134220-71134242 CTGAGTAACCAAACAGAGGATGG + Intergenic
1042659106 8:71134220-71134242 CTGAGTAACCAAACAGAGGATGG + Intergenic
1042884271 8:73530735-73530757 CTGAAAAAACAAAAAGATAAAGG + Intronic
1042884271 8:73530735-73530757 CTGAAAAAACAAAAAGATAAAGG + Intronic
1043021670 8:75009383-75009405 TCTAATAAACAGAAAGAGGCTGG - Intronic
1043021670 8:75009383-75009405 TCTAATAAACAGAAAGAGGCTGG - Intronic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1043730936 8:83680508-83680530 CTGTATGAACAGAAAGAAAAAGG + Intergenic
1043730936 8:83680508-83680530 CTGTATGAACAGAAAGAAAAAGG + Intergenic
1043880562 8:85537842-85537864 CTCAATACAAAGCAAGAGGATGG - Intergenic
1043880562 8:85537842-85537864 CTCAATACAAAGCAAGAGGATGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044972656 8:97634796-97634818 CTAAAAAAATAGAAAAAGGAAGG + Intergenic
1044972656 8:97634796-97634818 CTAAAAAAATAGAAAAAGGAAGG + Intergenic
1045101380 8:98847984-98848006 CTGAATAAACAGCATGCTGAAGG - Intronic
1045101380 8:98847984-98848006 CTGAATAAACAGCATGCTGAAGG - Intronic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1045937056 8:107692152-107692174 ATAAATAAACTGAAAGAGGAAGG + Intergenic
1045937056 8:107692152-107692174 ATAAATAAACTGAAAGAGGAAGG + Intergenic
1046191691 8:110803761-110803783 CTTAATTGACAGAAACAGGAAGG + Intergenic
1046191691 8:110803761-110803783 CTTAATTGACAGAAACAGGAAGG + Intergenic
1046331755 8:112725220-112725242 ATGACTAAACAGAAAAAAGAAGG + Intronic
1046331755 8:112725220-112725242 ATGACTAAACAGAAAAAAGAAGG + Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1047312737 8:123706317-123706339 CTGAATGGAAAGAAAGAGGTAGG - Intronic
1047312737 8:123706317-123706339 CTGAATGGAAAGAAAGAGGTAGG - Intronic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047556971 8:125942120-125942142 CAGAAAAACCAGAAACAGGAAGG - Intergenic
1047556971 8:125942120-125942142 CAGAAAAACCAGAAACAGGAAGG - Intergenic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1049012830 8:139898821-139898843 TTGAAAAAACAGAAACAGGCCGG + Intronic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1053264555 9:36701196-36701218 CTGAATAAAGGGCAAGAAGATGG + Intergenic
1053264555 9:36701196-36701218 CTGAATAAAGGGCAAGAAGATGG + Intergenic
1055204729 9:73714276-73714298 CTGAATAAATAAACAAAGGAAGG - Intergenic
1055204729 9:73714276-73714298 CTGAATAAATAAACAAAGGAAGG - Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1055224432 9:73977188-73977210 CTACATAAGTAGAAAGAGGAAGG + Intergenic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1057477688 9:95417212-95417234 CAAAATAAACACAAAGAGGATGG + Intergenic
1057477688 9:95417212-95417234 CAAAATAAACACAAAGAGGATGG + Intergenic
1058203176 9:102068733-102068755 CTGAAAAAAACGAAAGAGGCTGG + Intergenic
1058203176 9:102068733-102068755 CTGAAAAAAACGAAAGAGGCTGG + Intergenic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058212249 9:102183762-102183784 AGGAATAAATAGAAAGAGGAGGG - Intergenic
1058455968 9:105138479-105138501 CTCAATAAAGAGAAAGAATAGGG - Intergenic
1058455968 9:105138479-105138501 CTCAATAAAGAGAAAGAATAGGG - Intergenic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061648564 9:132027138-132027160 CTGAATCAACGGAGTGAGGATGG + Intronic
1061648564 9:132027138-132027160 CTGAATCAACGGAGTGAGGATGG + Intronic
1062379391 9:136279938-136279960 CTGCATCAACACAGAGAGGAAGG - Intergenic
1062379391 9:136279938-136279960 CTGCATCAACACAGAGAGGAAGG - Intergenic
1203364405 Un_KI270442v1:244099-244121 AGCAATAAACAGAGAGAGGAAGG + Intergenic
1203364405 Un_KI270442v1:244099-244121 AGCAATAAACAGAGAGAGGAAGG + Intergenic
1185558390 X:1039385-1039407 CTAAAAAAATAAAAAGAGGATGG + Intergenic
1185558390 X:1039385-1039407 CTAAAAAAATAAAAAGAGGATGG + Intergenic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1189191310 X:39109626-39109648 CTGAAATAACAAAAAGAGGAGGG - Intergenic
1189191310 X:39109626-39109648 CTGAAATAACAAAAAGAGGAGGG - Intergenic
1189540246 X:41979985-41980007 CAGAAGGAACAGAAAAAGGAAGG + Intergenic
1189540246 X:41979985-41980007 CAGAAGGAACAGAAAAAGGAAGG + Intergenic
1192057510 X:67787356-67787378 CTGATTATAGAGAAAGAGGCTGG - Intergenic
1192057510 X:67787356-67787378 CTGATTATAGAGAAAGAGGCTGG - Intergenic
1192709286 X:73563186-73563208 CGAAATGAAGAGAAAGAGGAGGG - Exonic
1192709286 X:73563186-73563208 CGAAATGAAGAGAAAGAGGAGGG - Exonic
1192742348 X:73905443-73905465 CTCAGTAAACAGAAAGAAGCGGG + Intergenic
1192742348 X:73905443-73905465 CTCAGTAAACAGAAAGAAGCGGG + Intergenic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1193426646 X:81347977-81347999 CTGAATATAGAGACAGACGATGG + Intergenic
1193919777 X:87410786-87410808 CTCAGAAAACAGAAAGATGAGGG - Intergenic
1193919777 X:87410786-87410808 CTCAGAAAACAGAAAGATGAGGG - Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194922720 X:99787092-99787114 ATAAATAAACACATAGAGGAGGG - Intergenic
1194922720 X:99787092-99787114 ATAAATAAACACATAGAGGAGGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196011647 X:110894427-110894449 CTGAAGAAGAAGAAAAAGGAAGG + Intergenic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1196320415 X:114333657-114333679 CTGAACAAACAGAACGAAGCTGG - Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1197228653 X:123979260-123979282 CAAAATAAACTGAAAAAGGAGGG - Intronic
1197228653 X:123979260-123979282 CAAAATAAACTGAAAAAGGAGGG - Intronic
1197526233 X:127567328-127567350 CTGAATAAACAGGAAGGGATTGG - Intergenic
1197526233 X:127567328-127567350 CTGAATAAACAGGAAGGGATTGG - Intergenic
1197620474 X:128742187-128742209 CTGAATATACAGGATCAGGAAGG + Intergenic
1197620474 X:128742187-128742209 CTGAATATACAGGATCAGGAAGG + Intergenic
1197884036 X:131199393-131199415 ATGAAAAAACAAAAAGAGGGGGG - Intergenic
1197884036 X:131199393-131199415 ATGAAAAAACAAAAAGAGGGGGG - Intergenic
1198156928 X:133970130-133970152 CTGCCTAAACAGCAACAGGAAGG - Intronic
1198156928 X:133970130-133970152 CTGCCTAAACAGCAACAGGAAGG - Intronic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198229371 X:134674805-134674827 CTGTAAAGACAGGAAGAGGAAGG - Intronic
1198276632 X:135100200-135100222 CAGAAATAACAGAAAGATGATGG + Intergenic
1198276632 X:135100200-135100222 CAGAAATAACAGAAAGATGATGG + Intergenic
1198756466 X:139987554-139987576 TGGACTAAACAGAAAGAGAAAGG - Intergenic
1198756466 X:139987554-139987576 TGGACTAAACAGAAAGAGAAAGG - Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199426623 X:147709294-147709316 CTGAAGTAATAAAAAGAGGATGG + Intergenic
1199426623 X:147709294-147709316 CTGAAGTAATAAAAAGAGGATGG + Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199569478 X:149253139-149253161 CTGAGTAAACAGGCAGAGGTTGG - Intergenic
1199569478 X:149253139-149253161 CTGAGTAAACAGGCAGAGGTTGG - Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199727206 X:150595697-150595719 CTGAATAACCTGAAAGACAATGG + Intronic
1199727206 X:150595697-150595719 CTGAATAACCTGAAAGACAATGG + Intronic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201496247 Y:14593761-14593783 GTGAAAAAACACAAAGAGGTGGG - Intronic
1201496247 Y:14593761-14593783 GTGAAAAAACACAAAGAGGTGGG - Intronic
1202025200 Y:20514623-20514645 CAAAATAAATAGAAAGTGGATGG - Intergenic
1202025200 Y:20514623-20514645 CAAAATAAATAGAAAGTGGATGG - Intergenic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic