ID: 1017731723

View in Genome Browser
Species Human (GRCh38)
Location 6:157323259-157323281
Sequence CCCGCGGAGTCTGGCGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017731723_1017731735 30 Left 1017731723 6:157323259-157323281 CCTGGGCCGCCAGACTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1017731735 6:157323312-157323334 CTCTCAGAGCGGGATGTGTGTGG 0: 1
1: 0
2: 0
3: 32
4: 337
1017731723_1017731731 6 Left 1017731723 6:157323259-157323281 CCTGGGCCGCCAGACTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1017731731 6:157323288-157323310 TCAGGGGCAAGCACAAGCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 108
1017731723_1017731734 20 Left 1017731723 6:157323259-157323281 CCTGGGCCGCCAGACTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1017731734 6:157323302-157323324 AAGCTAAGGGCTCTCAGAGCGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1017731723_1017731729 -10 Left 1017731723 6:157323259-157323281 CCTGGGCCGCCAGACTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1017731729 6:157323272-157323294 ACTCCGCGGGCTAAACTCAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1017731723_1017731732 7 Left 1017731723 6:157323259-157323281 CCTGGGCCGCCAGACTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1017731732 6:157323289-157323311 CAGGGGCAAGCACAAGCTAAGGG 0: 1
1: 0
2: 0
3: 9
4: 144
1017731723_1017731733 19 Left 1017731723 6:157323259-157323281 CCTGGGCCGCCAGACTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 1017731733 6:157323301-157323323 CAAGCTAAGGGCTCTCAGAGCGG 0: 1
1: 0
2: 1
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017731723 Original CRISPR CCCGCGGAGTCTGGCGGCCC AGG (reversed) Intronic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900240788 1:1616285-1616307 CGCCCGGGGTCTGGCGGCCGCGG - Intronic
900414658 1:2529472-2529494 CCTGCGGCCTCTGGCGGCCCTGG - Exonic
901540089 1:9910094-9910116 CCGGCCGGGTCGGGCGGCCCAGG - Exonic
901988349 1:13092873-13092895 CCCGGGGATCCTGGCGTCCCTGG - Intergenic
901993463 1:13133894-13133916 CCCGGGGATCCTGGCGTCCCTGG + Intergenic
902520304 1:17011895-17011917 CGCGCCGAGCCTGGTGGCCCAGG - Intronic
902920778 1:19665113-19665135 CCCGCGGGGCCTGGCGGCCCCGG + Intergenic
904724873 1:32539645-32539667 GCCGCGGGCTCTGACGGCCCGGG + Intronic
906246885 1:44282591-44282613 GCTGCTGAGTCTGGAGGCCCAGG - Intronic
910138450 1:83999278-83999300 CCCTCGGAGTCAGGAGGTCCTGG + Intergenic
915541904 1:156572650-156572672 GCCGCGGAGCCGGGCCGCCCAGG + Intergenic
921110922 1:212035743-212035765 GGCGCGGAGTTTGGCGGCCGGGG + Exonic
922287447 1:224182883-224182905 CACACCGAGTCTGGAGGCCCCGG - Intronic
922703403 1:227775526-227775548 CCCGCAGAGTTTGGAGGCCAAGG + Intronic
923630250 1:235644973-235644995 CCTGGGGTCTCTGGCGGCCCGGG - Intronic
1064167802 10:13001610-13001632 CCCGGGGAGCCCGCCGGCCCGGG + Exonic
1067037882 10:42932966-42932988 CCCGCTGAGACTGGGGGCGCGGG - Intergenic
1067512437 10:46907060-46907082 CCCACTGAGTCTGGAGGGCCTGG + Intergenic
1067649807 10:48144762-48144784 CCCACTGAGTCTGGAGGGCCTGG - Intergenic
1072416265 10:95249240-95249262 CCCTCAGAGGCTGGCTGCCCTGG - Intronic
1073124333 10:101140322-101140344 CCCCAGGAGTCTGGCATCCCCGG - Intergenic
1077191046 11:1256047-1256069 GCCGAGGAGTCTGGGGGGCCCGG - Intronic
1077357096 11:2123437-2123459 CCCCAGGAGTCTGGCCTCCCTGG - Intergenic
1077491366 11:2862410-2862432 CCCGCGGCCCCTAGCGGCCCAGG - Intergenic
1077495688 11:2885590-2885612 CACGCAGAGTCGGGCGGCGCGGG - Exonic
1081963458 11:47155037-47155059 CCAGGGGAGACTGGCGGCCCAGG + Intronic
1083945818 11:65921997-65922019 TCCGGGGAGGCTGGAGGCCCTGG + Intergenic
1084797634 11:71519056-71519078 CCCGAGGAGGCTGCAGGCCCGGG - Intronic
1085298177 11:75442669-75442691 CCAGCAGACTCTGGCAGCCCAGG - Intronic
1088823436 11:113475174-113475196 GCCGAGGAGAGTGGCGGCCCCGG - Exonic
1091498164 12:990741-990763 CCCGCGGCGCTTGGCTGCCCCGG + Intronic
1094832042 12:34304725-34304747 CCCGGGGATCCTGGCGTCCCTGG + Intergenic
1094838944 12:34334953-34334975 CCCGGGGACTCTGGGGTCCCCGG + Intergenic
1095752258 12:45726978-45727000 TTCGCGGACTCCGGCGGCCCTGG - Intergenic
1095958481 12:47819584-47819606 CCCGCGGAGCCGGGCGGGACAGG + Intronic
1097192278 12:57225308-57225330 TCGGAGGAGTCTGGCTGCCCGGG + Exonic
1101514427 12:105421164-105421186 CCCCTGGAGTCTGGTGGCCTGGG + Intergenic
1101640613 12:106583760-106583782 CGCTCGGGGTCTGGCGGCCAGGG + Intronic
1101910480 12:108857379-108857401 GGCGCGGCGTCCGGCGGCCCAGG + Intronic
1102298681 12:111756132-111756154 CCTGGGGAGTCTGGAGGCCGTGG + Intronic
1105440879 13:20414929-20414951 CCCGCGGAATCCGCCGCCCCAGG + Intronic
1112494793 13:99896115-99896137 CAGGAGGAGTGTGGCGGCCCAGG + Exonic
1113905281 13:113816616-113816638 ACCGCGGGGTCTGGTGGCCACGG - Exonic
1114075384 14:19158772-19158794 CCCGTGGACCCTGGCGACCCTGG + Intergenic
1114086887 14:19241208-19241230 CCCGTGGACCCTGGCGACCCTGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118366516 14:65101883-65101905 CCCGCGGATCCTGGGGGCCGGGG - Intronic
1119106797 14:71932516-71932538 CCCTCGGCGCCTGGCGGCTCCGG - Exonic
1120211911 14:81641723-81641745 CCCCTGGAGTCGGGCGGCCCAGG + Intergenic
1121312629 14:92943459-92943481 CCCGGGGTGTCCGTCGGCCCTGG + Intronic
1122153657 14:99737907-99737929 CCCTCGGCGACTGGCGGCCTTGG - Intronic
1124573011 15:30883269-30883291 CCCGCGGAGCCTGGTGGAGCTGG - Intergenic
1126109325 15:45166671-45166693 CCCGCGGGGTGGGGCGGGCCTGG + Intergenic
1127207207 15:56733374-56733396 CCCCCGGAGTGAGGCGGCGCAGG + Intronic
1128332225 15:66763306-66763328 CCTGGGGAGACTGGCGGCTCTGG + Intronic
1128344064 15:66842662-66842684 CGCCCCGAGTCTGGGGGCCCGGG + Intergenic
1132700775 16:1221112-1221134 CCCGGGGAGGATGACGGCCCAGG + Exonic
1132883787 16:2173591-2173613 CCCGGGGAGGCCGGCGGCCCCGG + Intronic
1136719789 16:32310668-32310690 CCCGCCGAGTCCGACGGGCCCGG - Intergenic
1136724834 16:32349069-32349091 CCCGCGGAGTCGGACGGGCCCGG - Intergenic
1136838164 16:33516948-33516970 CCCGCCGAGTCCGACGGGCCCGG - Intergenic
1136843159 16:33555109-33555131 CCCGCGGAGTCGGACGGGCCCGG - Intergenic
1137426327 16:48384702-48384724 CCCGCGGCGCCCGGAGGCCCGGG - Intronic
1139441888 16:66972534-66972556 CCCTTGGAGTCTGGCAGCCTAGG - Intronic
1139806207 16:69566664-69566686 CTCGCGGAGCCTGGCGGGGCCGG - Intronic
1140748149 16:77999186-77999208 CCCCGGGAGTCAGGCCGCCCAGG + Intergenic
1203001596 16_KI270728v1_random:168686-168708 CCCGCGGAGTCGGACGGGCCCGG + Intergenic
1203006642 16_KI270728v1_random:207101-207123 CCCGCCGAGTCCGACGGGCCCGG + Intergenic
1203133199 16_KI270728v1_random:1705092-1705114 CCCGCGGAGTCGGACGGGCCCGG + Intergenic
1203148334 16_KI270728v1_random:1817228-1817250 CCCGCCGAGTCCGACGGGCCCGG - Intergenic
1203153324 16_KI270728v1_random:1855407-1855429 CCCGCGGAGTCGGACGGGCCCGG - Intergenic
1144438444 17:15261384-15261406 CGCGCAGACTCTGGCGGCTCCGG + Intronic
1144760414 17:17704009-17704031 CCCGAGGAGCCGGGCTGCCCTGG - Intronic
1145057658 17:19714059-19714081 CCAGCGGTGTGTGGCGGACCCGG + Intronic
1146165379 17:30584273-30584295 CCCGCTGCTTCTGGCGGCACAGG - Intergenic
1147636350 17:41966816-41966838 TCCGCGCAGGCGGGCGGCCCCGG + Exonic
1150137639 17:62704309-62704331 GCTGCGGAGGCTGGAGGCCCGGG + Intronic
1151570473 17:74923185-74923207 GCAGCGGGGGCTGGCGGCCCCGG - Exonic
1152072528 17:78140980-78141002 GCCGCGGGGCCTGGTGGCCCGGG - Exonic
1155054524 18:22171880-22171902 GCCGCGGGGCCTGGCGGCGCTGG + Exonic
1156008598 18:32471022-32471044 GCCGCGGGCGCTGGCGGCCCCGG - Intergenic
1157529807 18:48410476-48410498 CCCTCGGAGTCTGTCGGGGCAGG + Intronic
1157544735 18:48539586-48539608 CCCGCGGGGTGTCGTGGCCCTGG + Intronic
1157826769 18:50819541-50819563 CCCGCTGCATCTGGCTGCCCCGG + Intronic
1160802028 19:974628-974650 CCTGCTGCATCTGGCGGCCCTGG + Exonic
1161031387 19:2059423-2059445 CCCGCGGAGGCAGGCGTCCCTGG + Intergenic
1161400792 19:4065699-4065721 CCCGGGGAGGGCGGCGGCCCGGG - Intronic
1161473558 19:4472890-4472912 GCCCCGGGGTCTGGGGGCCCTGG + Intronic
1162384621 19:10353649-10353671 GCCGCGGAGAGGGGCGGCCCCGG + Intronic
1166367348 19:42284348-42284370 CTCGCGGAGTCCGGCGGGCGGGG - Intronic
1167244062 19:48363474-48363496 CCCGGGGGGTCTGGGGGTCCAGG - Exonic
1167743922 19:51340153-51340175 CACGTGGAGCCTGGCGGACCCGG - Exonic
926196358 2:10765812-10765834 CCCACTGAGTCTGGCATCCCTGG - Intronic
928186413 2:29115254-29115276 GCCGCGAAGCCAGGCGGCCCCGG - Intronic
930115946 2:47718336-47718358 CCCGCTGAGCCTGGCGACCTTGG + Intronic
931762598 2:65431285-65431307 CCTGCGGGGTCGGGCGGCTCGGG - Intronic
932779075 2:74548948-74548970 CCCGCGCAGGCTGGGCGCCCAGG - Intronic
933698552 2:85238015-85238037 CCCACTGACCCTGGCGGCCCAGG - Intronic
935645479 2:105330176-105330198 CCCGCGTGGTCAGGCGGCCGCGG - Intergenic
938323032 2:130377792-130377814 CCCCCGGATCCTGCCGGCCCAGG - Intergenic
938489507 2:131754427-131754449 CCCGTGGACCCTGGCGACCCCGG + Intronic
941188280 2:162344309-162344331 CTCGCGGGGTGTGGCGCCCCCGG + Intronic
942061840 2:172234771-172234793 CCCGCACAGTCTGGCTGCCTGGG + Intergenic
944273141 2:197805130-197805152 CCCGCCGCGTCGGGCGGCGCCGG - Exonic
947551962 2:231052857-231052879 CCCGTGGAGCCTGGGAGCCCGGG - Intergenic
948211408 2:236195964-236195986 CCCGTGGATTCAGGCGGCTCTGG + Intronic
948567532 2:238896345-238896367 CCAGCGCAGCCTGGTGGCCCTGG - Intronic
1168757218 20:325891-325913 CCGGCGGCGTCTAGCGGCCCCGG + Exonic
1172390049 20:34559919-34559941 GCCTGGGAGTCGGGCGGCCCCGG + Exonic
1174870122 20:54174072-54174094 CCCTCGGAGTCTGGCCAGCCGGG - Intergenic
1180951931 22:19724365-19724387 CCTGCGGAGGCTGCGGGCCCGGG + Exonic
1181049009 22:20229982-20230004 CCCTCTGAGTCTTGCTGCCCAGG + Intergenic
1182211393 22:28679978-28680000 CCCGCCGAGTCCGACGGGCCCGG - Intergenic
1182297082 22:29315983-29316005 CCCCCGGAGTCAGGCCGCCCGGG + Intronic
1182667596 22:31970873-31970895 CCCACGGAGCCTGGCGGCCGCGG - Intergenic
1183126105 22:35783709-35783731 CACGTGGTGTCTGGGGGCCCTGG - Intronic
1185343008 22:50299924-50299946 TCCGGGGAGTCTGGCGGTGCCGG - Intronic
952430539 3:33218993-33219015 CCCCGGGAGTTCGGCGGCCCAGG - Exonic
966596200 3:181726415-181726437 CTCGCGGAGTGCGGCGCCCCGGG + Intergenic
966696376 3:182793824-182793846 CCCGCGGGGCCTCTCGGCCCGGG + Intronic
968551364 4:1225385-1225407 CCCGCGGATCCTGGCAGCGCCGG + Exonic
968617140 4:1582504-1582526 CAGGAGGAGGCTGGCGGCCCTGG + Intergenic
971005470 4:22369962-22369984 CCCCTGAAGTCTGGCGGTCCTGG - Intronic
981504165 4:145481971-145481993 CGAGCGGGGTCTCGCGGCCCGGG - Intronic
985760882 5:1747890-1747912 CCCTTGGTGCCTGGCGGCCCTGG - Intergenic
989570729 5:42943946-42943968 CCCTCGGAGTTTGGCAGGCCCGG + Intergenic
989581071 5:43033921-43033943 CCCTCGGAGTTTGGCAGGCCCGG + Intergenic
991054409 5:62306213-62306235 CCCGCGCCGTCTCACGGCCCCGG + Intronic
1002419276 5:179137284-179137306 CCTGAGGAGTCTGGTGGCCTTGG - Intronic
1002719081 5:181246987-181247009 CCCGGGGAGGCGGGGGGCCCCGG - Intronic
1012550561 6:100461388-100461410 CCCGGGGAGTCGGCCGGCCAGGG - Intronic
1013272871 6:108559632-108559654 CCCGCGGAGCCGGGCCGCGCAGG + Intergenic
1017719934 6:157236778-157236800 CCCGCGGAGTCAGCCCACCCTGG + Intergenic
1017731723 6:157323259-157323281 CCCGCGGAGTCTGGCGGCCCAGG - Intronic
1019351722 7:557124-557146 TCAGCGGAGTCTGGTGGCCCCGG + Intronic
1020204741 7:6105442-6105464 ACCGCGGAGTCCGGCGTCCCCGG + Intronic
1022092352 7:27115787-27115809 CCCGCTGAGGCCCGCGGCCCAGG - Intronic
1023064816 7:36366954-36366976 CCCGCGGAGCCCGCCGCCCCGGG - Intronic
1029361029 7:100088890-100088912 CCCGCGGCGTGCGGCGGGCCTGG - Intergenic
1032401271 7:131626044-131626066 CCTCGGGAGTCTGGCTGCCCTGG + Intergenic
1035018570 7:155787416-155787438 CGCGCGGAGCCTCGCGGTCCGGG - Intergenic
1035223559 7:157420943-157420965 ACCGAGGAGTCTGTCGCCCCAGG - Intergenic
1037667054 8:20978864-20978886 CCCTCGGAGCCTGGATGCCCGGG + Intergenic
1040981618 8:53251180-53251202 CCCCCGGCGACTTGCGGCCCGGG - Intronic
1043873757 8:85463587-85463609 GCTGCGGAGTCTGGCGGCGGCGG - Intergenic
1047262359 8:123274367-123274389 CCCGCGGAGTGTGGGGACTCAGG + Exonic
1047423673 8:124727524-124727546 CCCGCGGGGGCTGGATGCCCGGG - Intronic
1049098233 8:140561203-140561225 ACCGTGGGGTCTGGTGGCCCGGG + Intronic
1049641175 8:143716670-143716692 CCTGAGGCCTCTGGCGGCCCTGG - Intronic
1049668312 8:143858655-143858677 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049668728 8:143860254-143860276 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049669143 8:143861856-143861878 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049669558 8:143863458-143863480 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1049669968 8:143865051-143865073 CCCGCAGGGTCTCGGGGCCCAGG + Exonic
1051983794 9:23057593-23057615 CCCCTGGAGTCTGGCAGTCCAGG - Intergenic
1053007302 9:34612639-34612661 GCCGCGGAGTCTGGGGGCTGAGG + Intergenic
1053593164 9:39533808-39533830 CCTGCTGCATCTGGCGGCCCTGG - Intergenic
1053761758 9:41353234-41353256 CTCGCGGACACTGGCGACCCTGG - Intergenic
1053850898 9:42288516-42288538 CCTGCTGCATCTGGCGGCCCTGG - Intergenic
1054325250 9:63709501-63709523 CTCGCGGACACTGGCGACCCTGG + Intergenic
1054540350 9:66264353-66264375 CTCGCGGACACTGGCGACCCTGG - Intergenic
1054573143 9:66831469-66831491 CCTGCTGCATCTGGCGGCCCTGG + Intergenic
1057312956 9:93953073-93953095 CCCGCGGCGCCGGGCAGCCCGGG + Exonic
1058885849 9:109320725-109320747 CCCGCGCAGGCCGCCGGCCCGGG - Exonic
1060207519 9:121690883-121690905 AGCGGGGAGTCTGGCTGCCCTGG - Intronic
1062006324 9:134240165-134240187 CCCCCGGAGACTGGTGGCCCAGG + Intergenic
1185457620 X:318712-318734 CCCGCGGAGCCGAGCGGCCGCGG + Exonic