ID: 1017732911

View in Genome Browser
Species Human (GRCh38)
Location 6:157333784-157333806
Sequence CTCCAAGAGCAGGCAGGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017732903_1017732911 13 Left 1017732903 6:157333748-157333770 CCCATCTGTTCTGGGGGCCACTG No data
Right 1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG No data
1017732907_1017732911 -4 Left 1017732907 6:157333765-157333787 CCACTGTGGAGGAAGCGTCCTCC No data
Right 1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG No data
1017732898_1017732911 22 Left 1017732898 6:157333739-157333761 CCACTCATTCCCATCTGTTCTGG No data
Right 1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG No data
1017732897_1017732911 23 Left 1017732897 6:157333738-157333760 CCCACTCATTCCCATCTGTTCTG No data
Right 1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG No data
1017732904_1017732911 12 Left 1017732904 6:157333749-157333771 CCATCTGTTCTGGGGGCCACTGT No data
Right 1017732911 6:157333784-157333806 CTCCAAGAGCAGGCAGGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017732911 Original CRISPR CTCCAAGAGCAGGCAGGCGA AGG Intergenic
No off target data available for this crispr