ID: 1017738431

View in Genome Browser
Species Human (GRCh38)
Location 6:157383012-157383034
Sequence CCTGAAGTCCAGACTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017738431_1017738439 28 Left 1017738431 6:157383012-157383034 CCAGAAACAGTCTGGACTTCAGG 0: 1
1: 0
2: 1
3: 19
4: 163
Right 1017738439 6:157383063-157383085 TGCAAGTCTTCACCGTTTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 66
1017738431_1017738435 -10 Left 1017738431 6:157383012-157383034 CCAGAAACAGTCTGGACTTCAGG 0: 1
1: 0
2: 1
3: 19
4: 163
Right 1017738435 6:157383025-157383047 GGACTTCAGGGATTATATCTGGG No data
1017738431_1017738437 -8 Left 1017738431 6:157383012-157383034 CCAGAAACAGTCTGGACTTCAGG 0: 1
1: 0
2: 1
3: 19
4: 163
Right 1017738437 6:157383027-157383049 ACTTCAGGGATTATATCTGGGGG 0: 1
1: 0
2: 1
3: 6
4: 127
1017738431_1017738438 -7 Left 1017738431 6:157383012-157383034 CCAGAAACAGTCTGGACTTCAGG 0: 1
1: 0
2: 1
3: 19
4: 163
Right 1017738438 6:157383028-157383050 CTTCAGGGATTATATCTGGGGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1017738431_1017738436 -9 Left 1017738431 6:157383012-157383034 CCAGAAACAGTCTGGACTTCAGG 0: 1
1: 0
2: 1
3: 19
4: 163
Right 1017738436 6:157383026-157383048 GACTTCAGGGATTATATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017738431 Original CRISPR CCTGAAGTCCAGACTGTTTC TGG (reversed) Intronic
904416175 1:30362288-30362310 CCTGCAGTCCACACTGTTGTTGG - Intergenic
905016037 1:34779624-34779646 CCTGAACACCAGACTGTAACCGG - Intronic
905521885 1:38606741-38606763 CCTTAAGTCCTGGCAGTTTCTGG + Intergenic
905876718 1:41436144-41436166 CCCGTAGTCCCCACTGTTTCAGG - Intergenic
907735105 1:57104680-57104702 CATGAAGTCCAGGTTGTTTTGGG - Intronic
909344160 1:74565732-74565754 CCTCTAATCCAGAGTGTTTCTGG + Intergenic
909540393 1:76785068-76785090 TCTGAGGACCAGACTTTTTCAGG - Intergenic
911118288 1:94269465-94269487 CCTGAAAACCTGACTGTCTCAGG - Intronic
914433457 1:147640329-147640351 GCTGAAGACTAGGCTGTTTCAGG - Intronic
919743206 1:200992725-200992747 CCAGCAACCCAGACTGTTTCTGG - Intronic
924464337 1:244286414-244286436 CCTGAAGACCAGGCTGTACCAGG + Intergenic
1064040310 10:11956942-11956964 CCTGTAGTCCAGTCTATTTGGGG - Intronic
1064092312 10:12395533-12395555 CCTGAATTCCAGCCTGATCCTGG - Intronic
1064294127 10:14062715-14062737 CCTGAAGTCCACTCTGACTCAGG - Intronic
1069769931 10:70891753-70891775 CCAGCAGTCCAGGCTGTTTTTGG + Intergenic
1069836723 10:71313894-71313916 CCGGAAGTCCAGAACGTTCCTGG + Intergenic
1074417565 10:113280622-113280644 CCTTAAGTCCACACACTTTCTGG - Intergenic
1074644306 10:115428198-115428220 CCTGATTTCCTGATTGTTTCTGG + Intronic
1081644552 11:44780663-44780685 CCTGGAATCCAGTCTGTGTCTGG + Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1083044648 11:59723084-59723106 CCTGAACTCCAAACTTATTCAGG + Intronic
1085007485 11:73106493-73106515 CCTGAAGTGCAAACTGTTACAGG + Intronic
1085786371 11:79454941-79454963 CCAGAAGTCCAGACTTTCTCAGG + Intergenic
1086725304 11:90175088-90175110 TCTGAAGTCCAAAATATTTCTGG + Intronic
1089396876 11:118141870-118141892 ACTGAACTCCTGACTGCTTCCGG + Intronic
1089402770 11:118174035-118174057 CCTGTAGTCCTAACTGTTCCAGG - Intronic
1090767224 11:129886761-129886783 CCAGACGACCATACTGTTTCGGG + Intronic
1092515471 12:9207223-9207245 CCTGTATTCCAGACTGATACAGG - Intronic
1095489388 12:42717282-42717304 CCTGTACTCCAGGCTGTTTCTGG + Intergenic
1095576209 12:43743106-43743128 CCTGGAATACAGACTGTTCCAGG - Intronic
1096580802 12:52583556-52583578 TCTGAATTCCAGTCTGATTCTGG - Intergenic
1098055515 12:66500996-66501018 CCTGACCTCAAGACAGTTTCAGG + Intronic
1098345728 12:69501301-69501323 CCTGAAGTACAGACTGCTCATGG + Intronic
1100748189 12:97668295-97668317 CTTGGAGCCCAGACTGCTTCTGG + Intergenic
1106020773 13:25913222-25913244 TCTGAAGCCTACACTGTTTCAGG + Intronic
1106421536 13:29589763-29589785 CCTGGACTCCAGCCTGTCTCGGG - Intronic
1108634863 13:52323279-52323301 CCTGAAAGCCAGACTGCTTCTGG + Intergenic
1108652942 13:52499909-52499931 CCTGAAAGCCAGACTGCTTCTGG - Intergenic
1110111706 13:71755558-71755580 CCTGAAATTCAGACAGTTCCAGG + Intronic
1112873522 13:104005438-104005460 TTTAAAGTTCAGACTGTTTCTGG - Intergenic
1113920793 13:113908253-113908275 GCTGAAGTCCAGGTGGTTTCTGG + Intergenic
1116071352 14:40049419-40049441 GTTTAAGTGCAGACTGTTTCTGG + Intergenic
1116687716 14:48062384-48062406 ACTGCAGTCCAGACTGTTGATGG + Intergenic
1119553833 14:75538390-75538412 CCAGGAATCCAGACTGTTTAAGG + Intronic
1122474763 14:101999551-101999573 GCTGAAGTAGAGTCTGTTTCTGG + Intronic
1126233071 15:46350288-46350310 TCTGAATTCCATACTGTATCTGG - Intergenic
1126890967 15:53203756-53203778 TCTGACCTCCAGATTGTTTCGGG + Intergenic
1127563341 15:60162454-60162476 CCTGAAGTCCCCAGTTTTTCTGG - Intergenic
1127636147 15:60871840-60871862 ACTGAAGTCCAGACTTTATTTGG - Intronic
1128735240 15:70049920-70049942 CCAGGAGTCCAGACTGTGACGGG + Exonic
1129466514 15:75727248-75727270 CCTGGAGGCCAGACTGTAGCAGG - Exonic
1130859027 15:87869541-87869563 TTTGAAGTCCAAACTGTTTGTGG + Intronic
1131168868 15:90162303-90162325 CCTGAAGCTCAGAGTGTTTCAGG - Intronic
1131373004 15:91899143-91899165 CCAGAGTTCCAGAATGTTTCTGG - Intronic
1132178713 15:99735113-99735135 CCTGGAGTCCAGACCATTTTGGG - Intergenic
1132562085 16:600202-600224 CTGGAAGTACAGACTGTTCCAGG - Intronic
1133895772 16:9927519-9927541 CCTGAAGTCCAAACTTCTTCTGG + Intronic
1136289092 16:29260809-29260831 CCTGGAGGCAGGACTGTTTCAGG + Intergenic
1138276422 16:55738141-55738163 CCAGAACTCCTGAGTGTTTCTGG + Intergenic
1138585762 16:57969717-57969739 CCTTAAGTACAGGTTGTTTCTGG + Intronic
1143076341 17:4347210-4347232 TCTGAAATCCAGAATGTTTTTGG - Intronic
1143286475 17:5793610-5793632 CCTGAAGTTCAGGCTGATGCGGG - Intronic
1144157677 17:12522809-12522831 CCTGCAGTCCAAACAGTTTGTGG + Intergenic
1144217388 17:13068382-13068404 CCAGCAGTCCAGGCTGTTTTTGG + Intergenic
1146667676 17:34715745-34715767 CCTGAAGTCCTGACGGAGTCTGG - Intergenic
1150289155 17:63971736-63971758 ACTGAAGTCCAGCCAGTTCCAGG + Exonic
1151072732 17:71234671-71234693 CGTGCAGTACAGACTGTCTCTGG + Intergenic
1151818203 17:76482041-76482063 CCTGAGGTTCAGCCTGGTTCAGG - Intronic
1153671433 18:7415931-7415953 TCTAAAGTCCAAAGTGTTTCGGG - Intergenic
1154023263 18:10683867-10683889 CCTGAAGGCCAGTCTCTTTGAGG + Intronic
1154142152 18:11833683-11833705 CCTGAAGGCCATCCTGTTCCAGG - Intronic
1162228614 19:9245946-9245968 TCTGGAGCCCAGACTGTTGCTGG + Intergenic
1162494261 19:11014302-11014324 CCTGACGTCCTGACTGTTGCAGG + Intronic
1164700708 19:30281926-30281948 CCTCACGTCCAGGCTGCTTCTGG + Intronic
1165058879 19:33195212-33195234 CCTGAAGAAGAAACTGTTTCCGG + Intronic
929886599 2:45884131-45884153 CCTGAAACCAACACTGTTTCAGG + Intronic
931718582 2:65049339-65049361 CCTGAGCTCCAGGCTGTGTCAGG + Intergenic
937378661 2:121355637-121355659 CCTGAAGTTCACCCTGATTCAGG - Intronic
939473854 2:142660180-142660202 TTTGAAGACTAGACTGTTTCTGG + Intergenic
940840946 2:158581019-158581041 CCTTAAGTCCAGGATGCTTCGGG + Intronic
941520475 2:166536276-166536298 ACACAAGTCCAGATTGTTTCTGG - Intergenic
943210706 2:184962092-184962114 CATGCTGTCCAGACTGGTTCCGG - Intergenic
943764602 2:191647193-191647215 CCTGAAGTACAGACAGATTTGGG + Intergenic
944437292 2:199704001-199704023 TCTGAAATCAAGACTGATTCAGG - Intergenic
1168801368 20:645532-645554 CCTGAACTCCAGACTCATCCCGG + Intergenic
1170573781 20:17647691-17647713 CCTCAAGTCCATGCTGTTTCAGG - Intronic
1170710003 20:18781940-18781962 CCTGATGTCCAGCCTGTTCCTGG + Intergenic
1171364384 20:24613730-24613752 CCTGAAGTCCCCACTGTAGCAGG - Intronic
1172439652 20:34956326-34956348 GCTGAAGTCAGGACTGTTTGAGG + Intergenic
1174065678 20:47863362-47863384 CCTGACTTCCTCACTGTTTCAGG + Intergenic
1177082545 21:16658490-16658512 CCAGAAGGCCAGACTGTGCCTGG - Intergenic
1177107576 21:16978942-16978964 AATGAAATCCAGACTGTCTCAGG + Intergenic
1177827372 21:26098957-26098979 CCTGCATTCCAGACTGACTCAGG + Intronic
1178589622 21:33898442-33898464 TCAGAAGTCCAGGCTGCTTCTGG + Exonic
1178772073 21:35514791-35514813 CCTGAAGCCCTGGATGTTTCTGG + Intronic
1179955556 21:44736340-44736362 CCTGAAGTCCAGCCTGTCAGTGG + Intergenic
1181104603 22:20566383-20566405 CCTGAGGCCCAGACTGTCACAGG + Intronic
1181925981 22:26359011-26359033 GCTAAGGTCCAGACTGTTTATGG + Intronic
1182566768 22:31205983-31206005 CCAGAAATCCAGCCTCTTTCTGG + Exonic
1184465599 22:44667651-44667673 CCTCATGTCAACACTGTTTCTGG + Intergenic
949396076 3:3615892-3615914 CCTGAAGCCCAGTCTGTTCCTGG - Intergenic
952499023 3:33942130-33942152 CCTGAAGTGATGACTCTTTCAGG + Intergenic
955405974 3:58626040-58626062 CCTGAGGTCCAGAGGGGTTCAGG + Intronic
955730284 3:61977949-61977971 AATGAATTCCAGACTATTTCAGG + Intronic
959069812 3:101691800-101691822 TCTGAAGTCAAGCCTGATTCAGG - Intergenic
959126781 3:102299590-102299612 CCAGAAGTCTGGACTGTTTGGGG - Intronic
961584587 3:127911464-127911486 CCAGAAGTCCAGGCCCTTTCAGG - Intergenic
961684726 3:128621872-128621894 CCTGGAGGCCAGACTGTTCTAGG - Intronic
963841214 3:150108306-150108328 AATGAAATCTAGACTGTTTCTGG + Intergenic
967948256 3:194820986-194821008 CCTGCAGTATAGACTGTTCCAGG - Intergenic
967948546 3:194823047-194823069 CCTGAAGGCCAGACTGATTTGGG + Intergenic
970793698 4:19888975-19888997 CCAGAAGACCAGACAGTATCTGG + Intergenic
972241424 4:37197404-37197426 GCTGAACTCATGACTGTTTCTGG + Intergenic
972868921 4:43271675-43271697 CCTGAAGTGGAGACTGTTCCAGG + Intergenic
973803122 4:54498119-54498141 CATTAAGTCTAGACTGTTGCTGG - Intergenic
974075057 4:57160928-57160950 CCTGAAGTCAAGACTGATAAAGG - Intergenic
975078978 4:70251953-70251975 CCTGAATTCCAGAAGCTTTCTGG - Intergenic
980004805 4:127529786-127529808 CTTGAAGTCCAAACTATTTTTGG - Intergenic
984555820 4:181212833-181212855 CATGAAGTCCAGAATGTAACTGG + Intergenic
985734760 5:1572824-1572846 CCTGAAATCCAAAATGCTTCTGG + Intergenic
986168280 5:5294452-5294474 TCTGAAGCCCAGACTTTTTTGGG + Intronic
989401937 5:41017116-41017138 CATTAAGTCTAGACTGTTTCTGG + Intronic
990165819 5:52992174-52992196 CCAGAAGTACAGGATGTTTCAGG - Intronic
990537117 5:56733665-56733687 ACTGAAGACCAGACTGATTCTGG - Intergenic
990644865 5:57832796-57832818 ACTGAAGTCAAGGCTGCTTCAGG + Intergenic
990762348 5:59143451-59143473 GCTGAAGTCCAGACTGGGTCAGG - Intronic
992015949 5:72575376-72575398 CCTGAAGACCATAAAGTTTCTGG - Intergenic
995097654 5:108258100-108258122 CCCTAACTCCAGACTGTATCTGG + Intronic
996384308 5:122894696-122894718 CCTGAAGTGCTTACTGCTTCTGG + Intronic
997668074 5:135648240-135648262 GCTGAAGTCTTGACAGTTTCGGG + Intergenic
1000102355 5:158028344-158028366 CCTGAAGTCCAGATAGTTTTAGG - Intergenic
1004312032 6:14554363-14554385 CCTGAAGAGCAGGCTGTTTCAGG - Intergenic
1006296651 6:33172886-33172908 CCTGAACTTCAGTCTGTTTTGGG - Intronic
1006576524 6:35050470-35050492 CCTGAAATGCAGACCATTTCTGG + Intronic
1006914633 6:37586306-37586328 CCTGATGACCAGACTGATGCTGG + Intergenic
1007304575 6:40893918-40893940 TCTGAACTCCACACTGTTACTGG - Intergenic
1007981047 6:46158356-46158378 CCTGAATGCTAGACTCTTTCAGG - Intergenic
1008206574 6:48667204-48667226 CCAGAAGTCAGAACTGTTTCTGG - Intergenic
1014898466 6:126933045-126933067 GCTGAAATCAAGACTATTTCAGG + Intergenic
1017738431 6:157383012-157383034 CCTGAAGTCCAGACTGTTTCTGG - Intronic
1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG + Intergenic
1024451571 7:49551519-49551541 CCTGAAGTCCAGTCTGAACCTGG + Intergenic
1025961277 7:66224331-66224353 ACTAAAGTCCAGTCTGTATCTGG - Intronic
1027532737 7:79355052-79355074 CCTGAAGGCCAGGCTGCTTTGGG - Intronic
1028424338 7:90669653-90669675 CCTGAAGCTTAGACTATTTCTGG + Intronic
1034445806 7:151113711-151113733 TCTGAAGCCCAGCCAGTTTCCGG - Intronic
1036173754 8:6515996-6516018 CCTGCAGACCAGGCTGTTCCAGG - Intronic
1037322033 8:17652965-17652987 GATGAAGTCCAGGATGTTTCTGG - Intronic
1038097360 8:24329463-24329485 CTTGATCACCAGACTGTTTCTGG - Intronic
1038693301 8:29782650-29782672 CCTAAAGTACGGACCGTTTCAGG - Intergenic
1039366747 8:36936044-36936066 CATGAAGGCCACACTGTTTTGGG + Exonic
1039475950 8:37839472-37839494 CATTAATTCGAGACTGTTTCCGG + Intronic
1040563741 8:48547315-48547337 GCAGAAGTACACACTGTTTCTGG + Intergenic
1040633029 8:49238487-49238509 CCTGAAGTGGAAACTTTTTCTGG + Intergenic
1041495251 8:58478942-58478964 CCTGAGGTTCAGGCTCTTTCCGG - Intergenic
1041510683 8:58651956-58651978 CTTGAAGTTTAGACTGATTCAGG - Intronic
1043467239 8:80523211-80523233 TCTGAAGCCCATACTCTTTCAGG + Exonic
1043475995 8:80606607-80606629 CCTGAAGCTAATACTGTTTCTGG + Intergenic
1044085097 8:87934481-87934503 AATGAAGCCCAGAGTGTTTCAGG + Intergenic
1045555715 8:103213055-103213077 TCTGAAGGCCATTCTGTTTCTGG - Exonic
1045784533 8:105904866-105904888 CCTGAAGACAAGACTGTTAATGG + Intergenic
1046858332 8:119061685-119061707 TCTGAAGTCCACTCTCTTTCAGG + Intronic
1050889680 9:10808682-10808704 CCAGAAGTCAACACTGTTCCAGG + Intergenic
1051249241 9:15142596-15142618 CCTGAAGAGCAGCCTTTTTCTGG + Intergenic
1051871164 9:21739145-21739167 CTTGAAATCCAGATGGTTTCTGG + Intergenic
1053596999 9:39573033-39573055 CCTGAGGTCCTGACTGAATCTGG - Intergenic
1053854974 9:42329693-42329715 CCTGAGGTCCTGACTGAATCTGG - Intergenic
1054569257 9:66791964-66791986 CCTGAGGTCCTGACTGAATCTGG + Intergenic
1054972295 9:71102434-71102456 CATGAAGTCCTTCCTGTTTCTGG + Intronic
1056840907 9:89997373-89997395 GCTGAACTCTAGACAGTTTCAGG - Intergenic
1061753316 9:132795709-132795731 CCTGAAGTTCACGCTGTCTCGGG + Intronic
1062621458 9:137424073-137424095 CCTGGACTCCTGGCTGTTTCGGG - Intronic
1185950051 X:4422658-4422680 CATGAAGTCCATTCTGGTTCTGG + Intergenic
1186343838 X:8670671-8670693 TCTCTAGTCCTGACTGTTTCTGG + Intronic
1187564111 X:20431586-20431608 CCTGAACTCTGGACTGTTTCAGG + Intergenic
1188287482 X:28345323-28345345 CCCGATTTCCAGACTGTGTCTGG + Intergenic
1188860031 X:35244810-35244832 CCTGAGGTCCACCCTGTGTCAGG - Intergenic
1189595755 X:42563792-42563814 CCTGCACCCCAGACTGCTTCAGG + Intergenic
1191604655 X:63047657-63047679 ATTTAAGTCCAGACTGTTTTTGG + Intergenic
1194072977 X:89350606-89350628 GCTGAAGTCCAGAATGTCTGTGG + Intergenic
1194696662 X:97060877-97060899 CTTACAGTCCAAACTGTTTCTGG + Intronic
1198006792 X:132503201-132503223 CCCAAAGTCCAGGCTGTTTTGGG + Intergenic
1198450295 X:136760461-136760483 ACTGTAATCCAGGCTGTTTCTGG - Intronic
1199574793 X:149303221-149303243 TCTGAAATCCAAAATGTTTCTGG - Intergenic