ID: 1017738630

View in Genome Browser
Species Human (GRCh38)
Location 6:157384874-157384896
Sequence CCACATAACTAGAGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017738630 Original CRISPR CCACATAACTAGAGGAAGGC AGG (reversed) Intronic
904527425 1:31144366-31144388 TCAAGTAACTAGGGGAAGGCTGG + Intergenic
905827727 1:41038870-41038892 TCACATACCTAGTGAAAGGCAGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906477250 1:46177885-46177907 TCACACAATTAGAGGCAGGCAGG + Intronic
908436269 1:64109831-64109853 CCATATAATAAAAGGAAGGCAGG - Intronic
908782975 1:67708624-67708646 GCACATTTCAAGAGGAAGGCAGG + Intronic
909209857 1:72809144-72809166 GCACATAACTCCATGAAGGCAGG - Intergenic
912496539 1:110095379-110095401 CCTCATAACTGGACCAAGGCTGG + Intergenic
918011848 1:180594064-180594086 CAACAAAACCAGAAGAAGGCTGG - Intergenic
922584318 1:226722292-226722314 CCACATTCCCAGGGGAAGGCAGG - Intronic
1063260621 10:4385384-4385406 ACTCATCTCTAGAGGAAGGCAGG - Intergenic
1063775961 10:9264439-9264461 CTACATCACTAGAGGAAGGTCGG + Intergenic
1070564689 10:77594738-77594760 CCATCTAACTGGAGGGAGGCTGG - Intronic
1072805523 10:98421840-98421862 CCACATAACTGGTGGGAGACGGG + Intronic
1073773466 10:106760804-106760826 CCACATGACAAGGGGAAGGCCGG + Intronic
1074450369 10:113554620-113554642 CCACAGGTCTAGAGAAAGGCAGG + Intronic
1075783468 10:125032413-125032435 TCACAAAACCAGAGGAAGGACGG - Intronic
1077075924 11:702139-702161 CCTGATAACAAGAGGAAGGGTGG - Intronic
1079498489 11:21074031-21074053 CTGGAAAACTAGAGGAAGGCTGG + Intronic
1083270394 11:61569369-61569391 CCACAGAACTGGAAGAAGGGAGG + Intronic
1083456409 11:62781938-62781960 CCACATAAACAAAGTAAGGCAGG - Exonic
1084488269 11:69463744-69463766 CCACTGAACTGGAGGCAGGCTGG - Intergenic
1085257471 11:75183862-75183884 TCACATAACTAGAGAGTGGCAGG - Intronic
1085424768 11:76394190-76394212 AAAAATAACTAAAGGAAGGCTGG - Intronic
1086017954 11:82190211-82190233 CCACATATCTTCAGGTAGGCAGG - Intergenic
1086075506 11:82846899-82846921 CCACTTATCTAGAAAAAGGCTGG - Intronic
1088551720 11:111020076-111020098 CCACATAGCTAGAGGTTGGCAGG + Intergenic
1095133881 12:38574380-38574402 CCCCTTCACTAGAGGAAGACAGG + Intergenic
1095855088 12:46851453-46851475 CGACATAACGAAATGAAGGCAGG + Intergenic
1096519882 12:52179006-52179028 AGACATAACTGGAAGAAGGCTGG - Intronic
1097463174 12:59888922-59888944 ACACATAAGTATGGGAAGGCAGG - Intergenic
1098924268 12:76332165-76332187 CCTCATAAATAAAAGAAGGCAGG - Intergenic
1099188327 12:79539780-79539802 CAACCTCACTAGAGGCAGGCAGG + Intergenic
1102788516 12:115623989-115624011 AAACACAACTAGAGAAAGGCAGG - Intergenic
1103047492 12:117749423-117749445 AGAAATAACGAGAGGAAGGCAGG + Intronic
1106330399 13:28734183-28734205 TCTCATAAGAAGAGGAAGGCAGG + Intergenic
1107418577 13:40223919-40223941 CCACATCAGTGGAGGAAGGACGG - Intergenic
1107874662 13:44779661-44779683 GCACATCACTTGAGGCAGGCAGG - Intergenic
1111421068 13:88011559-88011581 CAACAGAACTAGAGGATGGTGGG - Intergenic
1112218467 13:97461004-97461026 CCACATCACTAGAGTTAGGAGGG + Intronic
1115694190 14:35878728-35878750 CCACATAACACAAGGAAGACCGG - Intronic
1116525999 14:45906094-45906116 TCACATAGCTAGGGTAAGGCAGG - Intergenic
1118891978 14:69917955-69917977 CCACATTACTAGAGGCAGGAAGG - Intronic
1122292723 14:100688246-100688268 CCACATGACTGGAGGGAGGCAGG - Intergenic
1122808226 14:104272110-104272132 CCATAAAACTAGAAGAAAGCAGG - Intergenic
1124903826 15:33849264-33849286 CCACATGCCTACAGGAAGGCAGG - Intronic
1127728179 15:61771777-61771799 ACCCATAACAAGGGGAAGGCTGG + Intergenic
1128281371 15:66397364-66397386 CCTCATTAGTAGAGTAAGGCTGG + Intronic
1131222845 15:90599208-90599230 CCACATTAAAAAAGGAAGGCAGG - Intronic
1133653689 16:7838168-7838190 CTACTTAACTAGAGGAACTCAGG - Intergenic
1138357898 16:56400008-56400030 CTGCATAACTAGAGAAACGCTGG + Intronic
1140672098 16:77289330-77289352 GCAGACAACTTGAGGAAGGCCGG + Exonic
1141374155 16:83514345-83514367 CCTCATAAGAAGAGGAGGGCCGG + Intronic
1144565834 17:16358448-16358470 CAACATTACTAGAGGAACACAGG - Intergenic
1150474939 17:65467718-65467740 CCACATACCTGGAGTCAGGCAGG - Intergenic
1153630131 18:7061655-7061677 CCACATCAGAAGAGGAAGGAAGG - Intronic
1155160850 18:23194365-23194387 CCACATAAAGACAGGAAGGAAGG - Intronic
1158456428 18:57612225-57612247 CCACACAACCAGGGGAAAGCAGG + Intronic
1158616923 18:58996469-58996491 CTGCATAACTAAAGGAAGCCAGG + Intergenic
1159939992 18:74399681-74399703 CCACAGAAACACAGGAAGGCTGG - Intergenic
1160731886 19:644938-644960 CCACATAAATACAGGAAGACTGG + Intergenic
1162110270 19:8396257-8396279 CCCCATACCTAGAGGATGCCAGG - Intronic
1166635425 19:44447386-44447408 CCCCATTTCTAGGGGAAGGCAGG + Intronic
1168714179 19:58517676-58517698 GCACAGAACAAGAGGAGGGCAGG + Intronic
926046039 2:9710337-9710359 CCACATCATTAGTAGAAGGCAGG + Intergenic
928076314 2:28267786-28267808 CCACCTCACTGCAGGAAGGCTGG + Intronic
928642738 2:33317772-33317794 CCACATAGCTGAAGGAAGGAGGG + Intronic
928661756 2:33508977-33508999 CCTCAGAACTAAAGCAAGGCTGG + Intronic
932195237 2:69777386-69777408 CCAGATAACTATAGGATGGGGGG - Intronic
935845226 2:107158866-107158888 CAACATAGCTTCAGGAAGGCAGG + Intergenic
936697650 2:114969633-114969655 ACACATAGCTACAGGAATGCTGG - Intronic
937210423 2:120265694-120265716 TCACTTAACTAGCGGATGGCAGG - Intronic
941767643 2:169315751-169315773 CCACAGAACTGGAGGCAGGGAGG + Intronic
942804712 2:179916657-179916679 CCAGATAACTAGTGAAAGTCTGG + Intergenic
943779143 2:191802412-191802434 CTAGATAACTAGCGGAAGGGAGG + Intergenic
944695769 2:202199138-202199160 CCAAATAACTAAAGGAATGAGGG + Intergenic
948375199 2:237516425-237516447 CCTCATCACTACAGGAAGGGAGG - Intronic
1175382538 20:58573699-58573721 GCACAAAACTGGAGGGAGGCTGG + Intergenic
1178537893 21:33425320-33425342 TCACAGCACTGGAGGAAGGCTGG - Intronic
1179710868 21:43212251-43212273 CCACACAACTAGAGGTTGGGAGG - Intergenic
1180186992 21:46145088-46145110 CCACAGACCTGGAGCAAGGCAGG - Intronic
1183520770 22:38295002-38295024 TCACAAAACTAGTGGAAGGCTGG + Intronic
1185316812 22:50182908-50182930 CCACGTTCCTAGAGGCAGGCGGG + Intergenic
954670863 3:52290737-52290759 CCAGATAGATAGAGGGAGGCAGG - Intronic
957692441 3:83589458-83589480 CCACGTAAGTACAGGAAGGTGGG - Intergenic
961087714 3:124083402-124083424 ACAGATAGCTAGATGAAGGCAGG + Intronic
962257932 3:133884979-133885001 CCAAATAACCAGAGGACGGCGGG + Intronic
964678462 3:159310469-159310491 CCATTCAACCAGAGGAAGGCTGG + Intronic
965389890 3:168092381-168092403 CCCCATAACTAGAAGATGGTGGG - Intronic
967306811 3:188067322-188067344 TGACATACCAAGAGGAAGGCAGG + Intergenic
967418981 3:189252550-189252572 CCAGAAAAGTAGAGGAAGGAGGG + Intronic
971439545 4:26665532-26665554 CTAGATAAGTAGAGGAAGTCTGG + Intronic
972022165 4:34328828-34328850 CCACAAAAATAGAGGAAGAGGGG + Intergenic
972137110 4:35905847-35905869 GCACAAAACTGGAGGCAGGCTGG - Intergenic
973998902 4:56490162-56490184 CCACACATGTAGAGGAAAGCAGG - Intronic
974275594 4:59717286-59717308 CCACATAACTTCATGAAGCCAGG - Intergenic
978258074 4:106717036-106717058 CCAAATAAGTAGAGGAAAGTGGG + Intergenic
978703199 4:111674252-111674274 CAAGATAGCTAGAAGAAGGCTGG + Intergenic
980802554 4:137770497-137770519 CCACCTAAATTGAGGAAGGCTGG + Intergenic
983191947 4:164764158-164764180 CCTCATCACTAGAGGAATTCAGG - Intergenic
983192042 4:164764964-164764986 CCTCATCACTAGAGGAATTCAGG + Intergenic
984909270 4:184656936-184656958 CCACAGAATGAGAGCAAGGCTGG - Intronic
986329432 5:6706744-6706766 CCATCTAACTTGAGGGAGGCTGG - Intergenic
989158584 5:38368613-38368635 ACAGATATTTAGAGGAAGGCAGG - Intronic
989428046 5:41318645-41318667 CAACTTCACTAGAGGAAGACAGG + Intronic
990667366 5:58088643-58088665 CCACATAAAAAGAGGAAGAATGG - Intergenic
993411128 5:87574445-87574467 ACACCTAACTACAAGAAGGCTGG + Intergenic
995857987 5:116614026-116614048 CCACAAAAGTAGAGGGAGGTGGG + Intergenic
998562957 5:143188488-143188510 CCAGAAAACTATAGGAAGGAAGG - Intronic
999911437 5:156205166-156205188 CCAGATAAGCAGAGGAAGTCTGG - Intronic
1001113646 5:168920452-168920474 CAACTTAACTAGAGGCAGGGAGG + Intronic
1004087351 6:12463369-12463391 ATACATAACTGGAGGAAAGCAGG + Intergenic
1004600397 6:17144637-17144659 CCCCATCCCTAGAGGAAGGAGGG - Intergenic
1005267547 6:24127473-24127495 TCACATAACTAGAGTAATGTAGG + Intronic
1006649280 6:35537475-35537497 CCACATTTCTATAGGAAAGCTGG + Intergenic
1007162663 6:39804667-39804689 GCAGCTAATTAGAGGAAGGCTGG - Intronic
1009369088 6:62879048-62879070 CCTAATATCTAGAGGAAGGGAGG + Intergenic
1011621203 6:89244394-89244416 CCACATCACTAGAGATCGGCTGG - Intergenic
1014455664 6:121631727-121631749 CCAGATAACTAGAAGCAGGAGGG + Intergenic
1014762559 6:125373205-125373227 CCACATGACTAGAGGGACTCAGG + Intergenic
1017738630 6:157384874-157384896 CCACATAACTAGAGGAAGGCAGG - Intronic
1017927657 6:158924259-158924281 CCACATAATGAGCGGAAGGTCGG + Intergenic
1018442307 6:163824496-163824518 CCTCTTCACAAGAGGAAGGCTGG - Intergenic
1021197354 7:17688286-17688308 TCCCATCACTAGGGGAAGGCAGG - Intergenic
1021551409 7:21874819-21874841 CCAAAAAATTAGAGGAAGGAAGG - Intronic
1021614330 7:22487027-22487049 TCACATAGATAGAGGAAGGAAGG + Intronic
1022122360 7:27321760-27321782 TCACTTAACTAGGGGATGGCAGG - Intergenic
1025251828 7:57356529-57356551 CCACAGAACTGGGGGCAGGCTGG + Intergenic
1027998216 7:85454531-85454553 CCACTGAACAATAGGAAGGCTGG - Intergenic
1028167454 7:87554409-87554431 CGACAGTCCTAGAGGAAGGCAGG - Intronic
1029211231 7:98909835-98909857 CAACAAAACTGGTGGAAGGCTGG - Intronic
1030104797 7:105978089-105978111 TCACATAACTAGGAGATGGCAGG + Intronic
1030649535 7:112102389-112102411 CCACACAACTAGAAAATGGCAGG - Intronic
1034680575 7:152925052-152925074 CCTGAGAACTCGAGGAAGGCGGG - Intergenic
1035686400 8:1526724-1526746 CCACATCAAGAGAGGAAGGAGGG + Intronic
1036518068 8:9463965-9463987 CCACATAACCACAGGGATGCTGG - Intergenic
1036547575 8:9786834-9786856 CCACATAGCTACAGTGAGGCAGG + Intergenic
1039044165 8:33434876-33434898 CCAGATAACAAGAGGCTGGCTGG + Intronic
1041115373 8:54530816-54530838 CCTCATAACTTGAGGATGGGGGG - Intergenic
1041181965 8:55258503-55258525 TCTCATAACTGTAGGAAGGCAGG - Intronic
1047820986 8:128520494-128520516 CCAAAAAACTTGAGAAAGGCAGG - Intergenic
1052238653 9:26245718-26245740 CCACATATTCAGAGGGAGGCTGG - Intergenic
1052796859 9:32931117-32931139 CCTTATAAAAAGAGGAAGGCAGG - Intergenic
1053444558 9:38141888-38141910 ACTCATAACTAGAAGAATGCTGG - Intergenic
1056804769 9:89720047-89720069 CCACATCATTAGAGGAAAGGAGG + Intergenic
1057229712 9:93313100-93313122 ACACAGAACTACAGGAAGTCAGG - Intronic
1058784593 9:108374704-108374726 CCAGGGAACTAGGGGAAGGCTGG + Intergenic
1061271796 9:129547956-129547978 GCACATTACTGGAGGAAGCCTGG + Intergenic
1185836634 X:3350783-3350805 CCACATTTCTAGAGGAAAGGGGG - Intergenic
1186856906 X:13635526-13635548 GTACATAACTGGAGGAAGCCTGG + Intergenic
1188548502 X:31336529-31336551 CCAGATAATTAGTGGAATGCTGG - Intronic
1189201477 X:39199659-39199681 CCTCATAAACAGAGGAAGTCAGG - Intergenic
1191056081 X:56242737-56242759 CCACAAAAATAAATGAAGGCTGG - Intronic
1194823720 X:98535256-98535278 CATCTTAACTAGAGGAAGACAGG + Intergenic
1195781125 X:108465698-108465720 CCAAATATCTAGAAGAAAGCAGG - Intronic
1199070703 X:143471730-143471752 TCACATAAATGGGGGAAGGCGGG + Intergenic
1199655517 X:149991212-149991234 CCACCTAACTATAGGAAGCTTGG - Intergenic
1199757034 X:150874423-150874445 CCACAGGAAAAGAGGAAGGCAGG + Intronic
1201248554 Y:12031864-12031886 ACACATAACTAGATGAAGCCTGG + Intergenic