ID: 1017739071

View in Genome Browser
Species Human (GRCh38)
Location 6:157389768-157389790
Sequence CAGTGGGTACAAAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017739071 Original CRISPR CAGTGGGTACAAAGGGTGGA AGG (reversed) Intronic
902205382 1:14864596-14864618 AAGTGGGTATAAAGGTGGGACGG + Intronic
905173514 1:36122986-36123008 CAGGGGGTGGAAAGGGTGAATGG - Intronic
905403317 1:37718010-37718032 CAGTGGGTACAAATGGCAGTAGG + Exonic
906350003 1:45050526-45050548 GAGTGGGCTCAAAGGGTGGAGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907954999 1:59219643-59219665 AAGAGGTTACAAAGGGTGCAGGG - Intergenic
909460142 1:75902361-75902383 CACTGGGGACAAAAGGGGGAAGG - Intronic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
911054662 1:93699629-93699651 CAGTGGGTTGAAAGGCTGGCTGG - Intronic
912734518 1:112138386-112138408 GAGTGTGTACAAAGTCTGGATGG - Intergenic
913357894 1:117944146-117944168 CAGTGGGGACAAAAGCTTGATGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
915986709 1:160473296-160473318 CAGTGGGTCAAAAGAGTGGGAGG + Intergenic
917598086 1:176550014-176550036 CAGTGGTTACTAAGGGCTGAAGG - Intronic
919196965 1:194298412-194298434 AAGTGGGTTCAAAGGCTGAAAGG - Intergenic
919976306 1:202615299-202615321 CAGTGGGCCCAGAGAGTGGATGG + Intronic
920071633 1:203306585-203306607 CAGAGGGAACACAGGGTGGGAGG + Intronic
920676511 1:208042062-208042084 CAGTGGGTGGAGAGGGTGGCAGG - Intronic
920783701 1:209020193-209020215 CTGTTGCTTCAAAGGGTGGAAGG + Intergenic
920941860 1:210491107-210491129 AAGTGGGAAGAAATGGTGGAGGG + Intronic
921817740 1:219583024-219583046 TAGAGGCTACAAAGGGTAGAGGG - Intergenic
922248758 1:223827003-223827025 CACTAGGTACAAAGTGAGGAAGG + Intronic
922494519 1:226046104-226046126 TAGTGGGTACACAGGGTCAAGGG - Intergenic
924245059 1:242075713-242075735 TAGCGGTTACAAAGGGGGGATGG + Intergenic
924638304 1:245809450-245809472 CAGTGAGTTCAAAAGGAGGAAGG + Intronic
1063367407 10:5499601-5499623 CAATCGGAACAAAGGGAGGAGGG + Intergenic
1063956008 10:11267795-11267817 AGGTGGGTGCAAAGGGGGGAAGG + Intronic
1064238124 10:13596370-13596392 CATTGGGTTCAAATGGTGGCAGG + Intronic
1065757071 10:28940593-28940615 CAGTGAGTACAAAGGGAGCAAGG + Intergenic
1067305901 10:45063764-45063786 AAGTGGTTTCAAAGGGTGAATGG + Intergenic
1069881305 10:71595571-71595593 CAGTGGTTACCATGGGGGGAAGG - Intronic
1069893337 10:71665530-71665552 CTGTGGGTGCAAAGGGTGTGAGG + Intronic
1071885286 10:89943166-89943188 GAGTGAGTGCAAAGGATGGAAGG - Intergenic
1072086326 10:92082960-92082982 CAGAATGTACAAAGGGTGAAGGG + Intronic
1074889327 10:117722078-117722100 CTCTGGGAACAAAGGGTGGGAGG - Intergenic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077964603 11:7115313-7115335 AACAGAGTACAAAGGGTGGATGG + Intergenic
1079250790 11:18786016-18786038 CAATGGGGACAAAGGAAGGAGGG + Intronic
1080026413 11:27620009-27620031 CAGTGAGTACTAAGACTGGATGG + Intergenic
1080855660 11:36109372-36109394 CAGTGGGAACATATGGGGGATGG + Intronic
1081235564 11:40643470-40643492 CTGATGATACAAAGGGTGGAGGG - Intronic
1082837329 11:57660965-57660987 CAGTGCGTACAAAGTGGGGGAGG - Exonic
1083744037 11:64725379-64725401 CAGTGGGGACACATGGGGGAGGG + Intergenic
1083752605 11:64769057-64769079 CAGTGTGTACCAAGTGTGGAGGG - Exonic
1085026763 11:73240852-73240874 CAGTGGGGAGAAAGGGTTTAAGG - Intergenic
1088741267 11:112769396-112769418 CCGTGGGGACCCAGGGTGGAAGG + Intergenic
1089290798 11:117437101-117437123 CAGTGAGTCGCAAGGGTGGAAGG - Exonic
1089868526 11:121652348-121652370 AAGTGGGGAGAAAGGGGGGAAGG - Intergenic
1092257590 12:6935962-6935984 CAATGGGTCCCAAGGGGGGAGGG + Exonic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1093241515 12:16682589-16682611 CAGTGGGTAAACATGGTAGAGGG - Intergenic
1093945752 12:25107634-25107656 TAATAGGTACAAAGGGTGGGAGG + Intronic
1096212178 12:49775267-49775289 CACTGGTCACAAAGGGTGAAAGG - Intergenic
1096212374 12:49776471-49776493 CATTGGTCACAAAGGGTGAAAGG + Intergenic
1100048814 12:90418565-90418587 CAGTGGTTACCAGGGGTGGTAGG + Intergenic
1102574288 12:113846224-113846246 CAGTGGGTACAAGAAGAGGAGGG + Intronic
1102927751 12:116839575-116839597 GAGTGGGTAAATAGGATGGATGG + Intronic
1103404390 12:120665056-120665078 CAGTGGGTGCAAGGGGTTGGGGG + Intronic
1104048663 12:125182139-125182161 TGGTGGGTGCTAAGGGTGGAAGG + Intergenic
1106495748 13:30272816-30272838 CAGTGTGTTCCAAGGGTGGGAGG - Intronic
1106627983 13:31440850-31440872 CAGAGAGTACAAAGGGAGGGGGG - Intergenic
1106818036 13:33430899-33430921 CAGAGGCTACAAAGGATAGAAGG + Intergenic
1108436541 13:50406558-50406580 GAGTGGGTACAAAAGGGAGAAGG + Intronic
1108880599 13:55109450-55109472 CAGAGGCTGGAAAGGGTGGAGGG + Intergenic
1112437154 13:99398751-99398773 CTGTGGAAATAAAGGGTGGAGGG - Intergenic
1113092457 13:106630048-106630070 CAATGTGTACAAAGGCTGCATGG + Intergenic
1113358738 13:109608855-109608877 GAATGTGTACAATGGGTGGAAGG + Intergenic
1115648771 14:35388324-35388346 CAGTGGGTACAAAGGATGCCTGG - Intergenic
1116221739 14:42096292-42096314 CAGAGGGCACAAAGGCTGCAGGG + Intergenic
1117051804 14:51867689-51867711 CTGTGGGGACAAAGTGTGGAAGG - Intronic
1118035582 14:61862775-61862797 CAGGGGTTAGAAAGGGTAGAAGG - Intergenic
1118718750 14:68578965-68578987 AAGAGGCTACTAAGGGTGGATGG - Intronic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1124491953 15:30163650-30163672 CAGTGGGCCCAGAGAGTGGATGG + Intergenic
1124751584 15:32374667-32374689 CAGTGGGCCCAGAGAGTGGATGG - Intergenic
1125975401 15:43946714-43946736 CAGTGGGTTCCCAGGATGGAAGG + Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130703936 15:86213928-86213950 CAGTGGTTACCAGGGGTTGAGGG - Intronic
1131046003 15:89316064-89316086 AAGTGGGTAAAGAGAGTGGATGG - Intronic
1131795540 15:96012269-96012291 CAGTGGTTACCAGGGGTTGAGGG - Intergenic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1134042529 16:11079440-11079462 CAGTCAGTCCAAAGGCTGGAGGG - Intronic
1134317413 16:13131868-13131890 CAGTGGTTAATAAGGGAGGATGG - Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1139954451 16:70686427-70686449 CAGTGGGTACAGTGGCGGGATGG + Intergenic
1141675288 16:85514369-85514391 CAGAGGGTGCAAAGGATGGGGGG - Intergenic
1142358443 16:89615050-89615072 CAGTGGGTGTCATGGGTGGAAGG + Intronic
1143402200 17:6653599-6653621 CAGCAAATACAAAGGGTGGATGG + Intergenic
1144930603 17:18855977-18855999 CACTGGCTTCAGAGGGTGGAGGG + Intronic
1144934005 17:18883127-18883149 CAGTGGTTCCCTAGGGTGGAAGG - Intronic
1146308893 17:31751842-31751864 CAGTGGTTACCAAGGGCTGAAGG + Intergenic
1147729550 17:42589778-42589800 CAGTGAATACAAATGATGGATGG - Intronic
1149681281 17:58508966-58508988 CAGTGGGGACCCAGGGTGGGGGG + Intronic
1152101790 17:78305755-78305777 CAGTGGGGACAGAGGCTGCAGGG - Intergenic
1152367491 17:79865022-79865044 CAGTAGCTATAGAGGGTGGAGGG - Intergenic
1154951137 18:21210996-21211018 CAGTGGTTGCCAAGGGTTGAGGG - Intergenic
1156578965 18:38353229-38353251 TAGTGTGGACAAGGGGTGGAGGG + Intergenic
1158269911 18:55701449-55701471 CAGAGGTTGCAAAGGGTGGTGGG - Intergenic
1158760638 18:60381643-60381665 GAGAGGGAAGAAAGGGTGGAGGG + Intergenic
1159831049 18:73278783-73278805 CAGTTGGTACCAGGAGTGGATGG - Intergenic
1160000191 18:75011012-75011034 CAGTGAGTAGGAAGGGTGGTGGG + Intronic
1161257349 19:3316675-3316697 CTGTGGGGAGAAAGGGTGGCTGG + Intergenic
1161707180 19:5827694-5827716 CAGTGGGTGCAGGGGGTGGGAGG - Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162507113 19:11092261-11092283 CAGTTGGGACAGAGTGTGGAAGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1164047627 19:21555949-21555971 CAGTGGGTACAACCCATGGAGGG - Intronic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1165292677 19:34900939-34900961 CAGTGGCTTCCAAGGGTTGAAGG + Intergenic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1166564593 19:43755727-43755749 CAGTGGGCAGAGTGGGTGGATGG + Intergenic
1167101893 19:47408814-47408836 CCGAGGGTACACTGGGTGGATGG + Intronic
925718495 2:6806740-6806762 CAGTGGGGACAGAGGATGGGAGG + Intergenic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
926306777 2:11643062-11643084 CGGTGGCTGCAAAGAGTGGAAGG + Intergenic
926575899 2:14580961-14580983 CGGTGGTTACAGAGGCTGGAGGG - Intergenic
927272476 2:21227502-21227524 CAGTGGTTACCAGGGGTGAAGGG - Intergenic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
928655008 2:33441264-33441286 CAGTGGCCACTAAGGGTGGGAGG - Intronic
929058327 2:37898391-37898413 CAGTGGGTAGAAAGTTGGGATGG - Intergenic
929190614 2:39136128-39136150 CAGTGGGCAGTATGGGTGGAGGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930633354 2:53778550-53778572 CAGTGGTTACCAGGGTTGGAGGG - Intronic
930688619 2:54335798-54335820 CTGTGGGCTCTAAGGGTGGATGG + Intronic
931554634 2:63488940-63488962 CAGTGGGTACCAGAGCTGGATGG + Intronic
933794430 2:85908171-85908193 CTGGGGGTAGAAACGGTGGAGGG - Intergenic
933811512 2:86035660-86035682 CAAAGGGTGCACAGGGTGGAGGG - Intronic
936459482 2:112702302-112702324 CAGTGGTTACCAAGGGTTGGGGG - Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937866526 2:126755755-126755777 CAGTGGGCACTAAGGCTGTAGGG - Intergenic
938318771 2:130348071-130348093 CACTGGGTACCCAGGGAGGAGGG + Intergenic
938337767 2:130514311-130514333 CAATGGAGACAAAGGGTGAAGGG - Intergenic
938352072 2:130606424-130606446 CAATGGAGACAAAGGGTGAAGGG + Intergenic
939114152 2:138041284-138041306 CTCTGGGGACAATGGGTGGATGG + Intergenic
939618010 2:144381906-144381928 CTGTGGGTAGAGAGGTTGGATGG + Intergenic
939926783 2:148184794-148184816 CAGTGAGCTCAAAGGATGGAAGG + Intronic
942639684 2:178048474-178048496 GAATGGATCCAAAGGGTGGACGG - Intronic
943475748 2:188353529-188353551 CAGTGACTACAATGGGTAGATGG - Intronic
945094092 2:206202857-206202879 GAGTGGGTACAGTGGATGGAGGG - Intronic
945118855 2:206437825-206437847 TTGTGGCTACCAAGGGTGGAGGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946817633 2:223595223-223595245 CAGAGTATACAATGGGTGGAAGG + Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
948380144 2:237545039-237545061 GAGTGGGGACAGTGGGTGGAGGG + Intronic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948980961 2:241494531-241494553 CAGTGGGTACGCAGGGTGTATGG - Exonic
1168778294 20:466878-466900 CACTGGGGAAAAAGGGTGAAGGG - Intergenic
1169334940 20:4748431-4748453 CAGTGGGTCCCCAGGGTGGGTGG - Intergenic
1169794956 20:9452024-9452046 CAGTGGGAACAAAGGCTAGGTGG - Intronic
1170543363 20:17411237-17411259 CAGTGGGTGCAAGGGGTCGGAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174110536 20:48195006-48195028 CAGTGGGTATGAAGGACGGAGGG - Intergenic
1175854663 20:62113972-62113994 CCCTGGGCACAAGGGGTGGACGG + Intergenic
1176667387 21:9700037-9700059 CAGTGAGGAATAAGGGTGGAGGG - Intergenic
1177237489 21:18411696-18411718 GAGTGGGAACAAAGGATGAAGGG - Intronic
1177767808 21:25478324-25478346 TAGTGGTTACAAAGCCTGGAGGG - Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181876009 22:25941407-25941429 CAGTGGGTAGTAAAGGTGGTTGG - Intronic
1182030239 22:27153539-27153561 CAGTGGTTACCAAGAGTGGTTGG - Intergenic
1182554130 22:31119866-31119888 CAGCAGGTACAAAGCATGGATGG - Exonic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183617481 22:38954422-38954444 CGGGGGGGACAAAGGGTGGGGGG - Intronic
1183772281 22:39937337-39937359 AAGTGGGGAGAAATGGTGGATGG - Intronic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1183808725 22:40236273-40236295 CAGAGGATACAAAGGGGGGTAGG - Intronic
949490099 3:4580826-4580848 CAGTGGGCACATAGGGTGAGTGG + Intronic
950751687 3:15134087-15134109 CACTGGGGACATGGGGTGGAGGG + Intergenic
951106546 3:18750575-18750597 CAATAGTTACAATGGGTGGAAGG + Intergenic
951832081 3:26942452-26942474 CAGTGGGTCCAATGCATGGAGGG + Intergenic
952268590 3:31810782-31810804 CAGTGAGTCCACAGGGTGTAAGG + Intronic
952741373 3:36738062-36738084 AAGTGGGGAGGAAGGGTGGAAGG - Exonic
954595771 3:51822993-51823015 CAGTGAGTCCAAGAGGTGGAAGG - Intronic
954695827 3:52425227-52425249 CAGTGGGTAGAAAGGGAGCTTGG + Intergenic
959913876 3:111794533-111794555 CAGTGGGGACAATTGCTGGAGGG + Intronic
961642183 3:128371627-128371649 CAGTGGGCACATGGGGAGGAGGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962379983 3:134890133-134890155 CAGTGGGTACCCCTGGTGGAAGG - Intronic
962791068 3:138812181-138812203 CAGAGGTTAGAAAGGGTGGGAGG + Intronic
964232398 3:154486624-154486646 CAGTGGGTACAAACCATGGAGGG + Intergenic
966098275 3:176232972-176232994 CAGTGGTTACCAAGGGTAGAAGG + Intergenic
966425862 3:179779007-179779029 CAGTAGGTATAAAGGCTTGAAGG + Intronic
967579003 3:191129815-191129837 CGGTTGATGCAAAGGGTGGAAGG - Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
971384165 4:26127833-26127855 CAGTGAGTACATGGGGTGGCTGG - Intergenic
974349350 4:60724440-60724462 CAGTGGGGAGAGAGAGTGGATGG - Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975770594 4:77717742-77717764 CAAAGGGAACAAAGGGTGAAGGG + Exonic
977551818 4:98450665-98450687 CAGAGGGTACATAGGAAGGAAGG + Intergenic
977953740 4:103003039-103003061 CAGTGAGTAGAAGGGGAGGAAGG - Intronic
978965391 4:114734729-114734751 CAGTGGGAACAGATGGTGGGAGG + Intergenic
979213432 4:118133613-118133635 CAGGGGGTACAAATGGTATAGGG + Intronic
981291718 4:143084186-143084208 CAGTCGGTACAAAGGCCTGAGGG - Intergenic
981812238 4:148789188-148789210 GAGTGGGTACAGATAGTGGAAGG + Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
984049724 4:174849419-174849441 CAGTGGATAACAGGGGTGGAGGG - Intronic
985118941 4:186620106-186620128 CAGTGGTTGCAAAAGATGGAGGG - Exonic
985407420 4:189651557-189651579 CAGTGAGGAATAAGGGTGGAGGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
991200051 5:63980893-63980915 CAGTGGGTACAGACCATGGAGGG - Intergenic
993590807 5:89793271-89793293 CAGTGGTTACCAAGGGAGCAAGG + Intergenic
994438155 5:99764085-99764107 CAGTGGGTACAGCCTGTGGAAGG - Intergenic
995266078 5:110162428-110162450 CAGTGGTTACTAGGGGTGGTGGG + Intergenic
996434011 5:123414334-123414356 CAGTGAGTACCAAGGATGGGGGG + Intronic
996701471 5:126454354-126454376 CTGTGCGTTCCAAGGGTGGAAGG + Intronic
997187730 5:131898916-131898938 CAGTGGGTACAGCCCGTGGAAGG - Intronic
998607390 5:143648964-143648986 GAGTGGGTAGAGAGGGTGGCTGG + Intergenic
998928418 5:147153729-147153751 CAGTGGTTACCAGGGGTGGAAGG + Intergenic
1002673452 5:180889525-180889547 CAGTGGGTGCAGTTGGTGGAGGG + Intergenic
1003565640 6:7219921-7219943 CAGTTGATACTAAGGGAGGAAGG + Intronic
1004307518 6:14514371-14514393 CTTTGGGTCCGAAGGGTGGAGGG + Intergenic
1005625273 6:27656583-27656605 CAATGGGTACCAAGGGCTGAAGG + Intergenic
1006191016 6:32209337-32209359 CAGAGGTTAGAAAGGGTGGCAGG + Intronic
1006752215 6:36385833-36385855 CACTGGGTACAAAATGTTGATGG - Intronic
1010211541 6:73366253-73366275 TAATGTGTACAAAGGATGGAAGG + Intergenic
1011208675 6:84930350-84930372 CAGTGTGTCAAAAGGGTGCACGG + Intergenic
1013744864 6:113333727-113333749 CAGTGAGGAGAATGGGTGGACGG + Intergenic
1015584671 6:134763350-134763372 CAATGGGTAGAAAGGGCAGATGG + Intergenic
1016630977 6:146230982-146231004 GAGTGGGTACCAAGGGTTGAAGG + Intronic
1017253233 6:152304665-152304687 ATGTGATTACAAAGGGTGGAAGG - Intronic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1019519632 7:1454832-1454854 CAGTGGCTCCCAAGGGTGGCGGG - Intronic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1020467074 7:8492738-8492760 CAGTGGGTCCCATTGGTGGAGGG + Intronic
1022158388 7:27682920-27682942 CAGTGGCTACCAGGGTTGGAGGG + Intergenic
1027226472 7:76247061-76247083 CAGTGTGGACACAGGCTGGAGGG + Intronic
1027840376 7:83303322-83303344 AAGTGGTCACAAAGGGTGGCTGG - Intergenic
1027953536 7:84850805-84850827 GAGAGGGTACATGGGGTGGAAGG + Intergenic
1031225314 7:119029629-119029651 CAGTGGTTACCAAGGGTTGGGGG + Intergenic
1031732773 7:125319141-125319163 CAGTGGTTACCAGGGGTTGAGGG + Intergenic
1033855234 7:145552877-145552899 TAATGGGTACAGAGGGCGGAAGG + Intergenic
1034062824 7:148108674-148108696 TGGTGGGTACAGAGGCTGGAAGG + Intronic
1035277168 7:157754528-157754550 CAGTGGGTGCAGAGAATGGAAGG - Intronic
1035943326 8:3929428-3929450 AAGTGGGTCCAAAAGCTGGAGGG + Intronic
1035963407 8:4162903-4162925 CAGTGGTTGCAAAGGGTTGGAGG - Intronic
1036207539 8:6816008-6816030 CAGTGGGCACTCAGGATGGAGGG - Intronic
1036412554 8:8516043-8516065 GAGTGGGGATAAAGTGTGGATGG - Intergenic
1036563632 8:9919333-9919355 CAGTGGGTACTAGTGGTGGGGGG + Intergenic
1037814041 8:22102627-22102649 CAGTGAGTACCAAGGGTGCCAGG + Exonic
1039439376 8:37584217-37584239 CACTGGGGAGAAAGAGTGGATGG + Intergenic
1039848386 8:41342314-41342336 GAGTGGCTTCAAAGGGTTGAGGG - Intergenic
1040874931 8:52141495-52141517 CAGAGGGCACAAAGTGGGGACGG - Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1043234275 8:77841914-77841936 CACTGGGTACTAATGGTAGAGGG + Intergenic
1044893925 8:96867873-96867895 CAGTGAAGACAAAGGGTGAAAGG - Intronic
1045235527 8:100349866-100349888 GAGAGGGTACAAAGGGGAGACGG + Intronic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049745715 8:144262452-144262474 GAGTGGGTACCGCGGGTGGAAGG + Exonic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1051400795 9:16679874-16679896 CAGTGGATACCAGTGGTGGAAGG - Intronic
1051452060 9:17207653-17207675 CAGTAGGTACAAAGCACGGAGGG - Intronic
1051470173 9:17430704-17430726 CAGAGGCTACAAAGGGTGGCAGG - Intronic
1055360823 9:75488583-75488605 CAGAGAGTTCAATGGGTGGAAGG + Intergenic
1055709740 9:79047785-79047807 TGGTGGTTACAAAGGGTGGAAGG - Intergenic
1056071695 9:82993805-82993827 CAGTGGGTCCAGCTGGTGGAGGG - Intronic
1057873019 9:98732319-98732341 CAGCGGGTAAAAAGGGGGCAGGG - Exonic
1058738297 9:107917305-107917327 CAATGTGTACAAAGCTTGGATGG - Intergenic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1062586630 9:137252584-137252606 CAGTGGGGCCAAAGGGGGGCTGG + Intronic
1203658428 Un_KI270753v1:20661-20683 CAGTGAGGAATAAGGGTGGAGGG + Intergenic
1187178485 X:16918766-16918788 CAGAGGGTAGGAAGGGTGTATGG + Intergenic
1187660754 X:21544716-21544738 CAGTGGGTACAGCCCGTGGAGGG + Intronic
1190181595 X:48197043-48197065 CAGTGGCAACAAAGTGTGGCTGG - Intronic
1190667348 X:52707433-52707455 CAGTGGCAACAAAGTGTGGCTGG - Intergenic
1190672070 X:52750975-52750997 CAGTGGCAACAAAGTGTGGCTGG + Intergenic
1190808479 X:53861712-53861734 CAGTGGCTGCAAGGAGTGGAGGG - Intergenic
1192156637 X:68751730-68751752 CATATGGTAGAAAGGGTGGAAGG - Intergenic
1192783597 X:74317529-74317551 CAGGGGGTACAATTGATGGATGG + Intergenic
1193990094 X:88296343-88296365 CAGTTGGAACAAAGTGTTGAAGG - Intergenic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1195422085 X:104687051-104687073 CAGTGGGTAGAAAAAGTTGAAGG + Intronic
1196898422 X:120360280-120360302 CAGTGGCTACAAAGGGACAAGGG - Intergenic
1198456909 X:136825808-136825830 GAATGGGTACAAAGTGTGAAGGG + Intergenic
1199339034 X:146654326-146654348 CAGTGGGTCCAAAGGCCTGAAGG + Intergenic
1200060051 X:153480152-153480174 CAGTGTGTCCCAAGGGTGGGGGG - Intronic
1201293018 Y:12440329-12440351 CTGTGGGTACAAGGGTGGGAAGG - Intergenic
1201743704 Y:17349083-17349105 GAGTGGCTACAAAGGGTGTTGGG + Intergenic